Wiki143:Administrators' noticeboard/IncidentArchive387

From Wikipedia, the free encyclopedia
Jump to navigation Jump to search

Template:Administrators' noticeboard navbox all

Troll user: The Dominator aka Dominik92

I have a problem with the above user. Yesterday we had a disagreement about sourcing on a couple of maps. I believe this ended well and everything was ok. However last night he rv several of my edits. Ok no big deal! Today I was havin a coverstaion with an admin and he jumped in out of nowhere. I asked him to stop and he did not. Again not really a big deal, however this user has posted this "Thanks, I'll keep an eye on the user though, because he does many unhelpful things that aren't blatant vandalism and attempts to manipulate the system" on djsasso's talk page. I feel from this users trolling actions he will follow me around wiki for the next several weeks. Here is what was posted yesterday, "Is this civil?

Left by Dominik92 on my talk page:

I see nothing on the talk that suggests consensus, all in all I really don't care, but I find the maps useful. An admin's opinion holds no more weight than any other user's opinion. I really don't think that a new users who violates policy with nearly every edit should be asking me to review policy. PS: we're building an encyclopedia here, and I see you're approach disruptive. For example, barnstars are given out to users who you feel have done exceptional work and mean absolutely nothing more than a pat on the back. And I think you're too new a user to be voting at RfA even though there is no official cutoff, sucking up to admins has nothing to do with building an encyclopedia. I suggest you refrain from giving out tips (that are 99% of the time incorrect) as a new user. About the same-sex marriage page, I really don't give a shit, I would prefer some visual representation, but eh. comment left on my talk page. by Dominik92


My responce: I find the above comment ill-hearted and unjust. No proof has been given how I have violated policy, and that I am disruptice because I award users who desire to be praised with barnstars? ALso the user is upset that I vote on wiki issues and admins?? In any case I have been around wiki for several months and decided recently to create an account because I like the project. Dominik assumes that I am 'new' when in fact I am not. I would be worried with some of his answers, "all in all I really don't care", "I really don't think that a new users who violates policy" no proof, "I see you're approach disruptive, [for giving out barnstars], "And I think you're too new a user to be voting at RfA", he thinks, is he the policy maker?, "from giving out tips (that are 99% of the time incorrect)" again where is the proof, and "I really don't give a shit" this was just rude.Thright (talk) 20:48, 16 March 2008 (UTC)"

I thought it was over, however with dominiks92 need to troll me, and watch me, it is not. Please see the number of times I had to rv my talk page, after I said it was over, over an hour after he posted the last comment. Please help thank you.Thright (talk) 19:09, 17 March 2008 (UTC)

I'm not even going to respond as it is a bit obvious to anybody who looks through the contributions and talk page histories. The Dominator (talk) 19:13, 17 March 2008 (UTC)
cause in point, no less than 4 minitues pasted and there is a responce. Why so fast?Thright (talk) 19:17, 17 March 2008 (UTC)
You mean case in point, and "why so fast" is probably because you were rather predictable here. Guy (Help!) 19:38, 17 March 2008 (UTC)
He was absolutely correct to re-insert the maps. There was no consensus to remove them and no evidence that any of the information on them was incorrect. The message left on your talkpage was a bit uncivil, but hardly worth branding as a "troll". Black Kite 19:24, 17 March 2008 (UTC)
While still pretty early in his career, Script error: No such module "user". is looking like a good case for mentorship, in that he's an apparent good faith editor whose lack of understanding of policy keeps landing him in hot water. I'd offer to mentor myself, but we've had some run ins (including one in which he accused me of not understanding the alleged policy that made Fuck (disambiguation) speediable), so I doubt he'd be thrilled with me. But I really think that mentorship would be advisable. Sarcasticidealist (talk) 19:26, 17 March 2008 (UTC)
(ec) The message was a misunderstanding as Thright has admitted here. The Dominator (talk) 19:28, 17 March 2008 (UTC)
Have to agree with Black Kite here, his actions were completely justifiable. Maybe a little harsher than needed in his comments, but hardly is he being a troll and trying to pick fights. I suggest, that the two of you just stop talking to each other for awhile to have a cool off period. -Djsasso (talk) 19:30, 17 March 2008 (UTC)
I did stop talking to him, and as a reward I got reported here : ) I think Thright is good faith on most occasions, but his accusing everyone that disagrees with him of not understanding policy is unacceptable behavior. I agree that mentorship would be of some benefit.The Dominator (talk) 19:34, 17 March 2008 (UTC)
My comment was more aimed at him that you, because I already talked to you about it. I do agree with you that he has to stop accusing people of not understanding policy when he himself is incorrect. But, that is mostly because he is brand new and he will figure it out as he goes along as long as people don't bite him to much. -Djsasso (talk) 19:36, 17 March 2008 (UTC)
Perhaps a checkuser should be done. I have been wondering by his edits if he was a sock of someone, and hadn't until now seen that someone already accused that other user of being a Thright sockpuppet. -Djsasso (talk) 19:41, 17 March 2008 (UTC)

Let me be clearer I am worried about this, "Thanks, I'll keep an eye on the user though, because he does many unhelpful things that aren't blatant vandalism and attempts to manipulate the system" If dominik92 agrees to stop following me around, - which is trolling is it not? - I will be happyThright (talk) 19:38, 17 March 2008 (UTC)

No trolling is when you purposefully say stuff to pick a fight. Users are more than welcome to watch your edit history to make sure you aren't causing trouble. That is why edit histories exist. -Djsasso (talk) 19:40, 17 March 2008 (UTC)
So that's considered uncivil by you, but calling me a troll and a vandal also on somebody else's talk page is OK? I want to watch your edits to make sure you aren't making mistakes, all in good faith. The Dominator (talk) 19:43, 17 March 2008 (UTC)
FOrget it, you all win This is not worth my time. I thought I liked the idea of wiki, butit turns out that most, - not all - people here just attack everyone. I am done with wiki, my time will be spent better somewhere else. I will take my masters degree and my managerial skills elsewhere.Thright (talk) 19:46, 17 March 2008 (UTC)
Please, I would love for you to stay, there's nothing I hate to see more than a discouraged user that could be a quality contributor, I just think that you should take the mentorship and not try to be so radical, like deleting the "fuck" page or blanking your user talk not that it violates policy, but just because it's not generally done and is somewhat rude, I strongly suggest that you get mentorship and give it another try here. The Dominator (talk) 19:52, 17 March 2008 (UTC)
Ok I thought about it I am leaving, I would like to thank everyone, - even those who opposed me - and wish you all the best here and in life. I have based my decision on the above and I belive that I cannot add value to wiki. Furthermore, this whole issue started with tags, and thus I find that a tag has been placed on SIP Magazine (Philippines)again! It turns out that this page was deleted a few days ago, yet my talk page gets flooded that I was in the wrong for placing the tag. In any case, it is not about one tag, but rather about interpersonal skills, and thus I say goodbye.Thright (talk) 20:13, 17 March 2008 (UTC)
Sigh. Left a (hopefully} positive message for Thright on his talkpage. Keeper | 76 | Disclaimer 20:40, 17 March 2008 (UTC)

History of For Better or For Worse

Hi, I may be misinterpreting something here so would appreciate someone else's take on it. This spin-off article was just "kept" from AfD and the nominator blanked via redirect (diff here). I reverted and now the same user has installed an super-sized clean-up tag. Was this AfD wrongly closed? If so could it be re-opened? Benjiboi 19:30, 17 March 2008 (UTC)

At best, the AFD should have been closed as "no consensus to delete" rather than as "keep" since there were 6 keep votes to 4 delete votes, which is hardly a consensus to keep. But since the people who voted to "keep" didn't present a single argument why the article is not a policy violation, it really ought to have been closed as "delete" since what counts at AFD is discussion, not nose-counting. —Angr If you've written a quality article... 19:35, 17 March 2008 (UTC)
I couldn't help but smile at the tag which says "It contains a plot summary that is too long compared to the rest of the article.". There is no "rest of the article" - it's all a plot summary. Should've been deleted. Black Kite 20:05, 17 March 2008 (UTC)
If I had found a tag that said "This article consists of nothing but plot summary", I would have used it. —Angr If you've written a quality article... 20:06, 17 March 2008 (UTC)
WP:DRV would not be inappropriate here. It is possible for the article to become encyclopedic, but experience suggests that such improvements are rare. Black Kite 20:08, 17 March 2008 (UTC)
There was no consensus to delete that article and this thread isn't really appropriate for ANI. --Pixelface (talk) 20:10, 17 March 2008 (UTC)
The article clearly fails policy and so consensus (which was fairly even anyway, and thus not consensus) is irrelevant. However, you are correct that this is the wrong venue. Black Kite 20:14, 17 March 2008 (UTC)
Pixelface, or anyone, where should this thread go; also per comments above could someone revisit the AfD and correct if "keep" should actually be "no consensus"? Benjiboi 20:21, 17 March 2008 (UTC)
It's now at DRV. —Angr If you've written a quality article... 20:43, 17 March 2008 (UTC)
Now that I think about it, this thread may be appropriate for ANI. Angr, you really shouldn't be redirecting articles after a deletion discussion has closed if you're the one who nominated the article for deletion. --Pixelface (talk) 21:56, 17 March 2008 (UTC)

Black Kite, you have it ass-backwards. Policy does not trump consensus; rather, consensus trumps policy (which is totally non-binding and non-normative). Wikipedia is not a bureaucracy. If people agree that X is the right thing to do, then it should be done, regardless of the "rules". Kurt Weber (Go Colts!) 23:59, 17 March 2008 (UTC)

In this case, however, the policy has consensus, and the AFD didn't. There was no consensus to keep this article. No one disputed that the article violates WP:NOT#PLOT. The people who voted "keep" simply didn't care that the article violates policy. —Angr If you've written a quality article... 00:04, 18 March 2008 (UTC)
So what? So-called "policy" on Wikipedia is totally non-binding anyway. It merely describes what people have done in the past; we are under no obligation to obey it in the present, in any situation. If there's not a consensus that the right thing to do is to delete the article, then there is no consensus to change the status quo, so the article should stay. Kurt Weber (Go Colts!) 00:12, 18 March 2008 (UTC)
The problem is that AfD is not a voting process and should not be treated as such, those who voted keep only made a difference because the closing admin decided to count their arguments as "votes", so in this case, definitely in violation of WP:PLOT and should be redirected. The Dominator (talk) 03:34, 18 March 2008 (UTC)

Arguing about the pointless rather than the issue.. the issue here is an article was closed at AfD as Keep but someone came along and blanked it and redirected it somewhere else - against Keep. So what's being done about that. - ALLSTAR echo 03:39, 18 March 2008 (UTC)

Well Angr was warned about redirecting the article after the deletion discussion closed and Black Kite took the article to DRV, so I'd call this thread resolved. --Pixelface (talk) 04:02, 18 March 2008 (UTC)

Threat posted on Roberto Carlos(singer) page

- - : this threat was posted not to long ago by a long term vandal. What should we do about it. So I just brush this under the carpet ; the same thing that Wikipedia does when ever this site has a death threat, or do I get law enforcement on the phone. I'm going to file a report on user:Mmbabies for making a death threat. Its a federal felony. Wikipedian Foundation ; keeps just standing there like some pole , and lets this idoit have a field day out there. I'm going to do something about this idoit for once okay.Rio de oro (talk) 20:16, 17 March 2008 (UTC)

Um OK! Don't let the trolls get to you. That is what they want. Theresa Knott | The otter sank 20:21, 17 March 2008 (UTC)
(ec) The edit introducing inappropriate content was quickly reverted and the user making the edit warned. What else should we do, bearing in mind the edit was made by a dynamic IP? Stifle (talk) (trivial vote) 20:22, 17 March 2008 (UTC)
This is User:Mmbabies, who has a history of making death threats, and who has been reported to his ISP, but nobody there seems to care. Corvus cornixtalk 20:34, 17 March 2008 (UTC)

Hmm could another admin take a look at Rio de oro 's contributions list. I smell a rat here but maybe I'm being overly suspicious. Theresa Knott | The otter sank 20:31, 17 March 2008 (UTC)

Uh.. Theresa . What you mean I'm a rat. —Preceding unsigned comment added by Rio de oro (talkcontribs) 20:40, 17 March 2008 (UTC)
She said she smelled a rat, not that you were a rat. -Djsasso (talk) 20:41, 17 March 2008 (UTC)
I dont get her deal here. I was just reporting a death threat that Mmbabies entered on a article. Okay. I was trying to follow WP:TOV Rio de oro (talk) 20:43, 17 March 2008 (UTC)
From your edit contributions you seem obsessed by him. Theresa Knott | The otter sank 20:47, 17 March 2008 (UTC)
Okay first off Miss. I filed aWP:ABUSE on him on 3 February 2008 on one of his latest socks okay. Second, me and several other people have been trying to get law enforcement to deal with his bs he HAS been CAUSING . OKAY. So Stop saying that. I dont what gives you the right to be "digging" around my contributions. That was a violation of my privacy. I didnt agree to you do that . Okay miss.Rio de oro (talk) 20:53, 17 March 2008 (UTC)
You have no rights of expectations of privacy concerning your contributions. That's what your Contributions page is for. You do have the right to expect privacy concerning your personal data. Corvus cornixtalk 20:57, 17 March 2008 (UTC)
A variety of editors appear to have sought the attention of ISPs and law enforcement to Mmbabies as described at Wikipedia:Long term abuse/Mmbabies and its Talk page. It appears there is no official response, but Wikipedia has tried the experiment of imposing very large range blocks which have not been completely successful. New ideas for dealing with this editor are welcome. EdJohnston (talk) 21:16, 17 March 2008 (UTC)

How many times do we have to say it here, Rio...revert, block, and ignore. That's all you have to do. These 'death threats' by him are never serious, and are more annoying than something to be freaked out about at all. He does this all the time, it's part of his sock modus, has been for months and months. There is no need to overreact to his threats because they're always the same, every time. I have been dealing with his vandalism for a year and the best thing to do for him until he gives up is to just hit revert on every edit and block him to discourage him from editing further. I understand your zeal in wanting to control him, but making a big deal out of every one of his Control+V'ed threats isn't going to help anybody and just give him more of the attention he desires. Nate (chatter) 21:20, 17 March 2008 (UTC)

Revert, block, ignore is the only way to effectively deal with this type of vandal. If we freak out of these "death threats" or for that matter suicide threats then we simply encourage the troll to continue. Rio de oro your repeated posting here even though the IP's are blocked and the police have already been contacted achieves nothing except giving the troll the attention he craves. Theresa Knott | The otter sank 21:25, 17 March 2008 (UTC)

I know by every comment we make here that troll gets fatter and fatter but it's very simple: If we stop talking about him, he'll just go away. Wildthing61476 (talk) 21:26, 17 March 2008 (UTC)
Agree, and Rio has been told this way too many times. Tiptoety talk 22:04, 17 March 2008 (UTC)
Hmm so he has. Theresa Knott | The otter sank 23:06, 17 March 2008 (UTC)

Request for deleted articles

Template:Hmbox These diffs explain the situation fairly well: [3] [4]

Should the deleted articles be provided? I think the fact that he's blocked is irrelevant here, as it wasn't related to mainspace content. Nousernamesleftcopper, not wood 21:02, 17 March 2008 (UTC)

I'd say provide 'em; if somebody reposts them to the mainspace, it's just going to quickly expose them as a sock. Sarcasticidealist (talk) 21:26, 17 March 2008 (UTC)
Dloh supported it too, so I've sent them. Nousernamesleftcopper, not wood 22:39, 17 March 2008 (UTC)

Possible Rms125a sock

Template:Hmbox Script error: No such module "user". has just reverted an edit by Script error: No such module "user". to the article Roland Arnall‎ with the edit summary "rv sockpuppet of banned editor". On his/her talk page, Hackney explained that Template:User-multi was the sockpuppet of Template:User-multi. I have never dealt with Rms125a, so I have no idea if this is reasonable. I therefore want to request the input of admins who have dealt with Rms125a. If this is true, Sovietjewelry should obviously be blocked. AecisBrievenbus 23:10, 17 March 2008 (UTC)

It's pretty straightforward. User:Danapointca is an RMS sockpuppet, who frequently stalks my edits. I reverted their edits to John Magee (bishop), then RMS as an IP (check the RMS SSP category) made this pair of edits. Another NY based IP (where RMS openly admits to living) reverted to the previous version, then lo and behold Sovietjewelry makes this edit, to the exact previous version. SirFozzie and Alison have ample experience, I'll ask them now. One Night In Hackney303 23:17, 17 March 2008 (UTC)
Yup. Pretty straightforward here. I've done the needful on the latest sock's page, and blocked. SirFozzie (talk) 23:22, 17 March 2008 (UTC)
Totally an RMS sock. Just block and move on. I've already blocked one or two today, but there'll be more tomorrow. And on it goes ... - Alison 23:25, 17 March 2008 (UTC)

Ronald Kessler FYI

FYI: Ronald Kessler's editing of his own article on Wikipedia, specifically his scrubbing of a correction he was forced to make on a recent NewsMax column, is starting to receive significant off-wiki attention. Shem(talk) 23:26, 17 March 2008 (UTC)

The article wasn't close to OK, with large parts of it sourced to political blogs. I've fixed that. Someone may want to drop a line on User:KesslerRonald's talkpage directing that account to WP:AUTO if it applies. Relata refero (talk) 23:53, 17 March 2008 (UTC)

I'm edging up on 3RR...

...for a candidate for the WP:LAME Hall of Fame. An IP, 209.247.22.149, insists that the site visited by Curious George and The Man With the Yellow Hat in one episode is "The United Kingdom". Per the show's website, it's Scotland. I've placed this on the talk page. The IP is, ahem, compromising, by changing "Scotland" to "The United Kingdom (Scotland, to be exact)". Even though it makes my brain ache to see that, I'm leaving it alone--because I've already reverted them 2x today. Am I right to be unsatisfied by this particular compromise? And strictly speaking, hasn't the IP crossed 3rr by reinserting the edits? (Apologies if this is really as lame as I think it is...)Gladys J Cortez 01:30, 18 March 2008 (UTC)

Pointless to argue. I've changed it to just Scotland, and if readers don't know where that is, they can follow the Wikilink; that's what they're for. I've watchlisted the page and will resist any attempt to introduce language barbarisms. --Rodhullandemu (Talk) 01:59, 18 March 2008 (UTC)
You have my gratitude. Gladys J Cortez 02:06, 18 March 2008 (UTC)

IP block

Could somebody look at the block of 58.120.227.83? It's indefinitely blocked after one contribution, and the talk is IP protected so that it can't be Template:Tled. The block log of the talk doesn't exactly explain the protection or indef block. It's listed as a TOR node, but it was my impression that these weren't supposed to be blocked indefinitely (and there hasn't been any vandalism of the talk to warrant the protection there). Thanks 74.220.207.195 (talk) 02:14, 18 March 2008 (UTC)

(ec) I've notified Ryulong, the blocking admin according to the log. If I can offer a suggestion, you might want to start there next time.... --jonny-mt 02:25, 18 March 2008 (UTC)
Block looks OK per Wikipedia:Open proxies, and User:Ryulong knows what he's doing. Have you asked him and why should it be unblocked anyway? --Rodhullandemu (Talk) 02:27, 18 March 2008 (UTC)
The protection expires, that's no big deal. I've reduced the block to 1 year, they usually (correct me if I'm wrong) stop being TOR nodes after awhile. Keilana|Parlez ici 02:32, 18 March 2008 (UTC)
It's still a TOR node.—Ryūlóng (竜龙) 03:52, 18 March 2008 (UTC)
Oh, and the IP posting this request is on a hosting server, which are mostly open proxies.—Ryūlóng (竜龙) 04:03, 18 March 2008 (UTC)
And it has an open port 80 too. Odd, that someone using proxies would want a proxy unblocked. Thatcher 06:28, 18 March 2008 (UTC)

Admin blocked because of questionable use of admin tools; needs review.

I have blocked Script error: No such module "UserLinks". because, upon review, it seems evident that there was objectionable use of admin tools used in a dispute against another editor. This needs to be scrutinized before proceeding, and protecting the encyclopedia is paramount; in addition, I cannot help but notice that this admin has been blocked three times in the past three months for edit warring. — Coren (talk) 19:28, 15 March 2008 (UTC) (e/c) Further note for the record, the block is set indefinite but the intent is "until such time as things have been reviewed". There is neither significance nor desire in that unbounded duration. — Coren (talk) 19:34, 15 March 2008 (UTC)

Unblock now. Dispute is over, admin tools were used once, block by Coren clearly punitive and inappropriate. No reason to block at this time. Christopher Parham (talk) 19:33, 15 March 2008 (UTC)
By the way "this needs to be scrutinized before proceeding" is a message you should take to heart before indefinitely blocking other admins who are not an immediate threat to anything. Hasty, unhelpful actions like this fan the flames. Christopher Parham (talk) 19:35, 15 March 2008 (UTC)
I was not aware that we got an allocation of tool abuse before something need to be made about it. — Coren (talk) 19:44, 15 March 2008 (UTC)
You must be new around here. ➪HiDrNick! 22:15, 15 March 2008 (UTC)
There's no allocation; but if the tool abuse was a one-time issue and has obviously stopped, indefinite blocking can no longer be described as preventative. You were welcome to bring up the action here; it's punitive blocking that is inappropriate. Christopher Parham (talk) 19:46, 15 March 2008 (UTC)

Could one of you two post some evidence please. We are not mindreaders. Theresa Knott | The otter sank 19:36, 15 March 2008 (UTC)

  • First question is... If you want review and issued the block, why did you handle the unblock request yourself? Avruch T 19:37, 15 March 2008 (UTC)

Coren, declining unblock requests of people blocked by you[5] is highly inappropriate, unless they trolled. MaxSem(Han shot first!) 19:39, 15 March 2008 (UTC)

(e/c) x 8 To both point above; my mistake. I mostly meant to answer the direct question, and I realize I should have done so outside the context of the unblock template. Will fix immediately. — Coren (talk) 19:44, 15 March 2008 (UTC)

If the problem is the single deletion of the opt-out page, then I think this block is both hasty and unnecessary, two things which blocks should not be. I think Arthur Rubin should be unblocked immediately to participate in this discussion, since there doesn't appear to be danger of harm from his actions. Avruch T 19:42, 15 March 2008 (UTC)

Just checking the edit history of the MfD. User:Carcharoth explained a policy violation there (diff). If I'd thought of that, I would have said it, but I could just see that it's an unconscionable and possibly illegal "contract". Copying, as well as producing the diff.

Quoting from this page version (the text has since been removed): "Keep in mind that when you sign this list, you fully are aware that you lose the right to [...] You also lose the right to complain about the bots themselves or the issues they raise." - here the generalised (not the specific) right to complain is not something that can be signed away. We can have a semantic argument over whether we mean complain or criticise, but Wikipedia is a co-operative and collaborative editing environment. Wording such as this, however "voluntary" it is, does not contribute to a collaborative editing environment, because it restricts the possibilities for discussing the bots and what they do. It promotes an environment where bot operators WP:OWN the bots, and contravenes the third of the m:foundation issues: "the wiki process" (we write articles and change community processes by discussion, not by fiat). To sum up: even in principle, people shouldn't be allowed to sign away their rights to make valid comments and criticisms, of a bot or anything (even if that gets labelled as "complaining"). They certainly shouldn't have such rights held to ransom over an opt-out process. Carcharoth (talk) 18:56, 15 March 2008 (UTC)

Furthermore, although I have separate disputes with beta and the bots ("beta and the bots" would be a good name for a rock band), the number of editors who do not have a dispute with beta is small enough that when I see a clear policy violation by beta, I don't see any reason not to note it.

Furthermore, I'm not the only one who removed the content from Beta's user page. Apparently someone signed it, then read the page and also found it unconscionable. I think it would be wise to notify User:Obuibo Mbstpo as well as User:Carcharoth of the AN/I thread. I don't want to violate WP:CANVASS. It appears that inciting violations of the pillars is not actually a policy violation, but perhaps it should be. — Arthur Rubin (talk) 19:48, 15 March 2008 (UTC)

Arthur Rubin abuse of sysop tools

  • Script error: No such module "UserLinks".

I'm in a hurry, work quickly approaching, but here's the basic rundown of issues, hopefully others can expand for me and help explain. I'll clarify anything I may need to when I return from work tonight.

I believe it's time the community reevaluated his access to administrative tools. LaraLove 19:40, 15 March 2008 (UTC)

A.R. seems to have a habit of edit warring, but RFC/arbitration would be better places for this discussion. Christopher Parham (talk) 19:42, 15 March 2008 (UTC)


I can see only one bad use of the tools. Maybe this needs an RfC, but there's nothing here meriting desysopping yet. A lot of pointy MfDs, that's all.--Docg 19:43, 15 March 2008 (UTC)
I can agree with this summary, and it demands an explanation from Arthur if not more serious proceedings. A block seems totally unnecessary and inflammatory, though. Avruch T 19:44, 15 March 2008 (UTC)
I don't have time to build an ArbCase right now, but this is the justification for his well-deserved block. LaraLove 19:46, 15 March 2008 (UTC)
Except Arthur's right, Wikipedia should never allow these kinds of agreements to take place (trading one thing for another). Especially trading away ones right to participate in discussion. —Locke Coletc 19:50, 15 March 2008 (UTC)
That he is right or not is immaterial; WP:POINT is bad enough without misuse of the tools. — Coren (talk) 19:54, 15 March 2008 (UTC)
WP:POINT? How was this misuse, these kinds of pages simply should not exist per my previous comment. —Locke Coletc 19:56, 15 March 2008 (UTC)
Deleting pages under criteria explicitly disallowed in userspace, citing IAR (you don't cite IAR, you just use it and if you're good enough, it slips under the radar), and threatening to block under a policy that gives exception to userspaces? Will (talk) 20:04, 15 March 2008 (UTC)
How is that page good for the encyclopedia? How does it help the encyclopedia? There's probably a policy somewhere that covers these kinds of "contracts" or "agreements", and I doubt it looks highly on them. Even if there's not, do you really need a policy to tell you what common sense should: We should never tolerate agreements to restrict editing unless they're part of dispute resolution (which this clearly isn't). —Locke Coletc 20:08, 15 March 2008 (UTC)

I am unblocking in 3 min, unless someone can tall me what this block is preventing? We can re-block if there's further problems.--Docg 19:47, 15 March 2008 (UTC)

(e/c x 11!) I agree with an unblock iff Arthur agrees to lay off the tools until this is resolved. — Coren (talk) 19:53, 15 March 2008 (UTC)
I don't believe there is support for requiring that condition. Christopher Parham (talk) 19:55, 15 March 2008 (UTC)
Yep, unblock. Take the case to arbcom if necessary. Addhoc (talk) 19:48, 15 March 2008 (UTC)
Absolutely. Highly inappropriate block. El_C 19:49, 15 March 2008 (UTC)
(ec x8) Looking at the diffs, I agree this should go to LYNCHMOB, if only for a stepping stone to arbitration, as we have no community desysop process. But still, AR's block threat does sound hypocritical, especially as he's had three 3RR this year. Will (talk) 19:51, 15 March 2008 (UTC)
You lost me at "agree." El_C 19:53, 15 March 2008 (UTC)
It wasn't a reply to you, it was a reply to Avruch and Glasgow - after the fifth edit conflict I got tired of placing the comment midway in. Will (talk) 19:56, 15 March 2008 (UTC)
I agree that AR's block threat was wr9ong and had he actually blocked anyone then I would be the first in line in asking the AC to desysop him. But he didn't. Theresa Knott | The otter sank 19:55, 15 March 2008 (UTC)

Unblocked to participate in discussion. MaxSem(Han shot first!) 19:57, 15 March 2008 (UTC)

  • Aye, unblock and use our processes. Deleting that article as T2 was a poor decision (I restored the history after Betacommand re-created it) but probably not worth a block at this time. Black Kite 19:56, 15 March 2008 (UTC)

Anyway, he's unblocked now. Christopher Parham (talk) 19:57, 15 March 2008 (UTC)

I think the issues of the Betacommandbot/Optout page may be Civility and AGF, I must admit I find the bolded entry somewhat confrontational and not particularly conducive to collaborative editing. Furthermore, AR placing a note warning of blocking for 3RR didn't necessarily mean he was goingto do the blocking, just that 4 reverts places anyone at risk. Those would be my AGF takes on it. I do agree that 3 blocks recently is somewhat of a concern.
PS: I have not been too involved with the betacommand issues. Do others think the stern approach on the optout page is necessary?Cheers, Casliber (talk · contribs) 19:59, 15 March 2008 (UTC)
Personally I think the first bolded sentence is fair enough but so obvious that it's unecessary. The second is clearly wrong and totally ignorable. Theresa Knott | The otter sank 20:16, 15 March 2008 (UTC)
We need to specify that it's clearly policy that it's ignorable. I think it's clear, but Lara apparently doesn't believe it's ignorable, and beta clearly doesn't believe it's ignorable, or he would have agreed to the strikeout. I apologize for being baited by beta. I should know better, by now. — Arthur Rubin (talk) 21:18, 15 March 2008 (UTC)
And, for the record, I didn't threaten to block anyone. I stated that anyone who agreed to the condition should be blocked. As an involved admin, I wouldn't do the blocking, although I would probably withdraw from Wikipedia if the condition agreed to as a policy. — Arthur Rubin (talk) 22:20, 15 March 2008 (UTC)

The deletion and the block relate to issues that may be accepted at an ongoing arbitration request so that can be left aside for now, though I will be suggesting that the main parties involved here that are not already parties to that request, ie. User:Arthur Rubin and User:Coren, be added to the request. Arthur is right, though, that there does need to be a clear statement somewhere in policy that informal gag rules and trade-offs and divisive interpersonal contracts (however voluntary they are) are extremely destructive to a spirit of collaboration. I did struggle to find a policy where this sort of behaviour is disallowed, and my arguments about about WP:OWN and the third foundation principle were rather weak, but we can't expect policy to explicitly cover everything. Carcharoth (talk) 22:59, 15 March 2008 (UTC)

Seems like a case of WP:BEANS in action to me. We don't have a policy on it because it's a pretty obscure thing to do. Perhaps we need more of a catch-all policy against behavior that goes against the spirit or goals of Wikipedia to cite in cases like this. --Infophile (Talk) (Contribs) 03:42, 16 March 2008 (UTC)

Whew. Long day at work. Good times. So, here's my take. Considering he deleted a page under an invalid criteria and cited Ignore All Rules, then made two pointy MFDs, then threatened to block Beta (or, rather, have him blocked) for an offense that not only has he been blocked three times in two or so months, but for an offense that doesn't even apply to the page Arthur was edit-warring with Beta on... Beta's own subpage. Then, as if that weren't enough, he dropped a template warning on my talk page. Seriously? Telling me to look at the Welcome page so that I, an admin with over 18,000 edits, can learn how to contribute to the encyclopedia. The rest was tldr, but the point is that admins don't drop template warnings on other admin's talk pages. Clearly, in my opinion, he was losing his grasp on wikireality and needed a few hours to chill out and realize what he was doing. He's been with the 'pedia for quite some time, but 2008 seems to be going downhill for him. LaraLove 03:52, 16 March 2008 (UTC)

The template on your page seemed like an attempt to be funny and informative. That said, the block was inappropriate as there was no immediate issue, and any long-term problems with Arthur belong at RFC or arbitration. Christopher Parham (talk) 04:05, 16 March 2008 (UTC)
Betacommand isn't an admin. And Betacommand hadn't just gotten a final warning telling him to stop using his admin tools in this situation, including warning users, considering his abuse of the tools. LaraLove 05:38, 16 March 2008 (UTC)
Actually, beta had gotten multiple final warnings about various things, including misuse of rollback, which used to be an admin tool. But that's not entirely relevant. Then again, I haven't had a valid final warning for misuse of admin tools, either. — Arthur Rubin (talk) 09:00, 16 March 2008 (UTC)
Lara, do you see several people saying that the block of Arthur Rubin was inappropriate? Maybe you could consider listening to them? I'm not going to defend what Arthur Rubin did, as that is not how I would have handled things, but Arthur is discussing things and talking to you. Calling for him to be blocked or desysopped is an over-reaction. I will say again that if you and Coren disagree over that, then you, Coren and Arthur Rubin need to take this to arbitration as a "dispute between admins". Unless you want to try and resolve this before it reaches that stage? Pre-emptive blocks of admins because someone thinks they've abused their tools is not how things are done here. In any case, the last time I checked, blocking an admin doesn't stop them using their tools (of course, in practice it does stop them using their tools as using their tools through a block is considered a reason for desysopping). Carcharoth (talk) 10:30, 16 March 2008 (UTC)
As I've stated on my talk page in a different context, what I saw was (a) an admin tool (delete) being used in furtherance of a content dispute (b) continuing dispute, and (c) threat that an admin tool (block) will be used. What clearer definition of preventative block would you prefer? — Coren (talk) 14:35, 16 March 2008 (UTC)
Arthur, you'll note that Beta no longer has rollback privileges, so if you want to use that as a comparison, are you saying you agree it's time to take your admin privileges? I doubt it. As far as the warning goes, apparently it was valid, because you were subsequently blocked for ignoring it. As Coren pointed out above, you abused your tools, which appears to me is something the community agrees on. So, Carcharoth, while the community does not agree that Arthur should have been blocked, it is something I obviously endorse considering I posted the justification for it above. While blocking admins doesn't technically stop them from doing anything, considering they can unblock themselves, it's understood that if you're blocked, you treat it as such and go through the same venue as everyone else, just as Arthur did. So (a) deletion of page under invalid criteria citing IAR and no policy, (b) two pointy MfDs, (c) threat to block Beta for 3RR (something Arthur has been blocked for three times this year) on his own subpage, which is not a blockable offense, (d) ignored warning. It was my opinion, which I continue to stand by, that he needed to be blocked at that point while it was brought to the community's attention because I believe his block log and actions during this dispute have shown him to lack the necessary judgment and restraint expected of an admin. As Coren noted, a clear example of a preventative block. LaraLove 20:43, 16 March 2008 (UTC)
For what it's worth, there is clearly nothing WP:POINTy about the MfDs. Beta has shown no interest in discussion, so it seems to me to be WP:POINTy to attempt to discuss it before making the strikeout edit and then the MfD. The delete may have been inappropriate, but it still seems to be that allowing gag rules is contrary to the principles underlying Wikipedia. As for the second MfD, I should have initiated discussion first, but I thought fairness required that I open MfDs on all copies of the material, and I withdrew the MfD and requested others withdraw their delete !vote as soon as I became aware that ZScout was open to discussion. I'll wait to comment in the RFAr until a few more points are brought up, so I don't use my entire space repeating points made by others. — Arthur Rubin (talk) 01:18, 17 March 2008 (UTC)
I'm sorry, Arthur, but I find both MfDs to be pointy. Mostly because they cite no policy, and also considering you cited IAR in your rogue deletion prior to the first one. Betacommand is actually quite receptive to discussions presented to him in a civil manner. Straight up deleting his page as you did, then turning to MfD was not at all the constructive way to go. LaraLove 02:21, 17 March 2008 (UTC)
"Betacommand is actually quite receptive to discussions..." is clearly false, but could we defer this until RfAr β2 is resolved. Even though I think it was opened prematurely, it is open, and such discussions should only be in one place. — Arthur Rubin (talk) 14:39, 18 March 2008 (UTC)

John254 has pointed out the following at the arbitration case. Wikipedia:BLOCK#Inappropriate administrative actions states: "Blocks may not be used to sanction administrators for the abuse of administrative privileges." - while the wording (which was added by John254 around a month ago) could do with some work, this is, I believe, an already generally accepted principle. Preventative blocks may seem fine, as long as there is a clear danger, but most times people will disagree whether there was a clear danger or not. In general, discussion should be used for a lot longer than was the case here, and then go to arbitration. Blocking between admins can all too easily escalate into wheel-warring. This wasn't the case here, but please let's not risk that in future. Carcharoth (talk) 06:42, 17 March 2008 (UTC)

Where is the discussion for this change? And, as an aside, why is he posting as a party despite not being listed as one? LaraLove 13:09, 17 March 2008 (UTC)
I noticed this change when it happened and I support it, especially in light of Archtransit's block of me. A change does not need to be discussed. If nobody objects, it stands. Jehochman Talk 13:15, 17 March 2008 (UTC)
I agree with it as well. Admins and editors are bound by the same rules, there isn't a special set of rules and offences for admins. Orderinchaos 06:55, 18 March 2008 (UTC)

Michael & Hephaestos, the last chapter

Not the most pressing problem Wikipedia has, but this has gone on for way, way, way too long.

Once, long ago, there was a vandal fighter by the name of Hephaestos. This was back at the dawn of Wikipedia, before most of you had even heard of Wikipedia. In his time, he was the preeminent vandal fighter, a model that such legends like Zoe & RickK modelled themselves on. Then he encountered a problem user by the name of Michael, who in the end drove him from the project.

In any other story, that would be the end; this has been the end of the story of many vandal-fighters. But I've since discovered that this saga has continued, below the radar.

Even before Hephaestos left, it was clear that Michael could be obsessed with certain things. Like a punk band called Crass -- & with Hephaestos. Michael created countless sock puppets to harass Hephaestos -- & since Hephaestos ended his time with Wikipedia, he has used these to vandalize Hephaestos' user & talk pages. Have a look at the history of those pages. So I decided enough is enough: no one needs to edit the page of a long-departed user, so I sprotected indefinitely the user page.

If this doesn't put an end to this obsessive behavior, I will then protect both. The saga is now over; Hephaestos deserves to exercise his right to vanish. It's time to start enforcing his right. -- llywrch (talk) 05:09, 17 March 2008 (UTC)

Sounds reasonable. I remember dealing with a bunch of those socks, back in the day. Not sure if this will bring a complete close, but it may help a bit. – Luna Santin (talk) 05:15, 17 March 2008 (UTC)
I'm surprised it hasn't been fully protected already. We often do that with userpages of retired users, even if they aren't a vandalism target. Hut 8.5 07:45, 17 March 2008 (UTC)
I'm fairly sure everything is protected. I know I did such to the talk page last year.—Ryūlóng (竜龙) 08:07, 17 March 2008 (UTC)
C.Fred -- of whom I never have heard -- protected the user page last July, but that protection expired this January. You did protect the talk page a week ago, after BetaCommand -- for reasons I cannot imagine -- unprotected it in January 2007. What's-his-name apparently discovered the protection of the user page had expired this month & resumed his attacks. -- llywrch (talk) 02:22, 18 March 2008 (UTC)
(ec x 2) I'm more than familiar with dealing with the vandal involved and, yeah, he's still active. Please feel free to indef protect both user and talk pages. I certainly endorse your actions here. If Hephaestos needs his account re-activated, he should be able to contact someone via email who can then do the necessary - Alison 08:08, 17 March 2008 (UTC)
IIRC it used to be protected, and we used to get the socks posting lots of unprotect requests, make sure the protect message is clear and keep an eye on it for the almost inevitable new admin honouring such a request. --81.104.39.63 (talk) 19:28, 17 March 2008 (UTC)
I've gone ahead and indef full-protected his userpage (I see Ryulong did the talk page). Hut 8.5 07:36, 18 March 2008 (UTC)

Pure Reason Revolution/Jon Courtney/User:Justpassinby

This is a complicated case involving vandalism, possible sockpuppetry and WP:BLP issues, so I wasn't certain where to report it and came here instead! Justpassinby has a long history of tendentious editing of Pure Reason Revolution, including past vandalism (see User_talk:Justpassinby) and a past sockpuppetry incident. The sockpuppetry case included a possible sockpuppet account of User:Joncourtney. Jon Courtney is the name of the lead guy in the band Pure Reason Revolution, but the one edit made back then was insulting towards the band and seemed to be by Justpassinby. Subsequently, Jon Courtney was created as an article. Justpassinby tried a speedy delete, which was rejected, then an AfD that failed (narrowly). During that time, he made claims of plagiarism against Courtney but then agreed to withdraw these. Since then, Justpassinby vandalised the article.[6] There was then one edit by the Joncourtney user[7] — I presume this was Justpassinby. Of course, if it really was Jon Courtney, then there are conflict of interest issues. Also see discussion on WP:BLP noticeboard. Basically, help! This all needs investigating, but I also think some quick action could be taken by admins. Thanks. Bondegezou (talk) 15:12, 17 March 2008 (UTC)

Further dubious editing continues... I've also reported possible sockpuppetry at Wikipedia:Suspected sock puppets/Justpassinby (2nd). Bondegezou (talk) 17:32, 18 March 2008 (UTC)
Please don't block me. I'll be good from now on Justpassinby (talk) 18:05, 20 March 2008 (UTC)

Image:Techcrunch-transparent-photshop.gif

Template:Hmbox

Image:Techcrunch-transparent-photshop.gif

Is there a way to get User:BJBot to use some kind of exception tag or whitelist entry for fair-use images that are exceptions to the rule that fair-use images must be used in at least one article. Discussion at User talk:BJBot#Image:Techcrunch-transparent-photshop.gif is not occurring soon enough, because the bot keeps adding the template. Is there some kind of "hang-on" tag to use so at least some discussion can occur without the bot continuing to add the template?

This is important also because User talk:BJBot sections get archived if no discussion occurs in 3 days in those sections.

Here is the last version of the image with the template: [8]

This image meets Wikipedia:Non-free content criteria exemptions. See the image page for the reasoning. --Timeshifter (talk) 14:49, 17 March 2008 (UTC)

Hang on a minute. The fair use reason is that it doesn't render properly because it is a transparent gif? I don't understand. Why do we need to use a company logo for that? Theresa Knott | The otter sank 15:19, 17 March 2008 (UTC)
Hardly matters, since Template:Tl obviously applies. —Random832 15:22, 17 March 2008 (UTC)
Doesn't look obvious to me. This is a company logo. Presumably trademarked. I removed the resolved tag. Let let others take a look. Theresa Knott | The otter sank 15:32, 17 March 2008 (UTC)
File:Coca-Cola logo.svg
The Coca-cola logo, which does not violate NFCC to use here (and good luck getting it deleted from commons)
Trademark has nothing to do with copyright. Image:Coca-Cola logo.svg is both a lot more trademarked, and a lot more public-domain, than the image we're discussing. —Random832 15:43, 17 March 2008 (UTC)
Indeed. Trademark is not considered in WP:NFCC so it's restriction do not apply. Marking as resolved again. EdokterTalk 16:26, 17 March 2008 (UTC)
Theresa, I have argued on Commons and elsewhere that our focus on copyright in deciding whether an image is free is unhelpful and that other commercial rights such as trademarks need to also be considered as they represent a considerable restriction on the uses images can be put to. That argument has not seen much success, it seems that "free" in the Wikimedia context has been widely interpreted to mean "not subject to copyright" not "not subject to any commercial right which may limit the legally permissible uses of the image". As well as trademarks, we ignore other rights - like that of museums and galleries to disallow photography. The works being photographed may be out of copyright but those that own the collections have a commercial interest in limiting photography - to sell their own photographs, postcards etc. Such rights have been successfully vindicated in many jurisdictions, but again isn't something that we seem to factor in when describing an image as "free". WjBscribe 16:30, 17 March 2008 (UTC)

(unindent) I don't understand the technicalities too well, but thanks for keeping the image. --Timeshifter (talk) 17:31, 17 March 2008 (UTC)

The problem is that, unlike copyright, trademark is heavily context-dependent. The H&R Block logo is simply a green square. Any green square, if used in the context of promoting a tax preparation company, would be a trademark infringement. Should we ban all images of green squares from Wikipedia? Of course not. There are words that are trademarked - many of these are used as article titles. —Random832 18:03, 17 March 2008 (UTC)
This is confusing. I've seen images marked Template:Tl and Template:Tl get removed from an article as unjustifiable fair use, then deleted as orphaned fair use. Are logos subject to NFCC or not? Gimmetrow 21:51, 17 March 2008 (UTC)

I think the points WJBscribe raises are interesting. The Coca-Cola logo we count as free, even by Commons' definition of free. But, imagine what would happen if you tried to use it commercially. It's not really free. --Hammersoft (talk) 17:49, 18 March 2008 (UTC)

Admin assistance needed FOR admin assistance in Articles_for_deletion/List_of_hooligan_firms

Man, I never thought I'd have to file one of these, but:

On March 13, I submitted "List of hooligan firms" for deletion via AFD
[9] as it violated WP:NOT#DIR. Yes a few of the users involved with that particular article & group protested. That's normal.
March 16, I decided in the name of WP:BOLD to simply close the thing, considering it was a list and therefore a violation of policy:
dif of course, it got removed a few times, which I expected:
[10]
[11]
[12]
At that point I gave up for the evening and came back the next morning. An admin Rambling Man had been called in and he and I spoke about the revert, very civiliy. However, he decided to "shut the door" as it were with this message [13] The users contesting the deletion as well as the admin are all members of a group that would have contributed to this list, as such, his involvement is COI. Additionally, he has stated that he will allow a violation of WP:NOT#DIR by allowing this list to be retained, even go so far as to actually ask if this is a list. I'm specifically asking that his conduct be examined as I belive that it constitutes COI, and that his involvement in the aforementioned AFD is not allowed. It's still standing so a DRV wouldn't be appropriate at this time.

Kosh Sez We don't need no stinkin FUR!! 18:25, 17 March 2008 (UTC)

Kosh, you are specifically not allowed to close AfDs for any reason that you are the nominator for. Had you not done that, I don't believe there would be any problem here. Rambling Man has done absolutely nothing wrong and has been way more civil than other editors/admins would have been in the same situation. He was friendly, to the point, and corrected where you were obviously in the wrong. What action do you want here? Because, so far, all you've done is draw attention to yourself. I would recommend a "back away slowly and quietly" approach...but that's just me. Keeper | 76 | Disclaimer 18:31, 17 March 2008 (UTC)
So you closed an AFD you started... after three days... when you're not an admin... accused others of vandalism for reverting it... threatened anybody who stayed in your path... edit-warred to restore your bogus close... and then decided step into the lion's den here? You should just fall back and count your graces that you didn't run into a block-happy admin. east.718 at 18:34, March 17, 2008
Yeah. What he said. And said better than me. Keeper | 76 | Disclaimer 18:36, 17 March 2008 (UTC)
Indeed. That article is actually a drama, vandalism and sockpuppet magnet (I've got it watchlisted, and have had to make a number of reverts and blocks because of it recently), but it's undoubtedly a valid article. The OP would be well-advised to read up on deletion policy before submitting another AfD. Black Kite 19:07, 17 March 2008 (UTC)
SO this is ok:

Sorry, I'm confused, if we disallow lists, why do we have so many featured lists? You raised the AFD to make a point. Read the text, " the deletion process proceeds based on Wikipedia community consensus" - not on your single decision that this is "just a list" which fails to meet policy. You're the only editor who believes that this article does violate policy. You do not have the consensus, the article will be kept. Simple as that. And, while we're here, consensus can overrule policy, that's how policies evolve and improve. The Rambling Man (talk) 17:12, 17 March 2008 (UTC)

I don't think so. I was accused of WP:POINT, despite my explaining twice that this was not a WP:POINT. Let's also not overlook the fact that he;s stating "Consensus over-rides policy" which has been proven false. Policy CAN be changed by consensus, but that's seperate to this AFD. While we're at it, check WP:NOT#DIR and note that it states that lists are one of things Wikipedia is not (outside of the listed exceptions). OH, and I love the part where you said I edit warred. I reverted vandalism to that AFD 3 times. I closed it per WP:BOLD WP:IAR with a note showing only that. As far as the "revert and be reported" That's not threating, it's a statemnt of fact, that why we have WP:3RR. Now, AGF and have a nice cup of tea (to quote an admin I know :) ) Kosh Sez We don't need no stinkin FUR!! 19:50, 17 March 2008 (UTC)

Regardless of how you think the AfD should have been closed, you shouldn't have closed it. You were the nominator. Everyone knows what you think. By closing it, you have pushed your own POV, nothing more, nothing less. Rightuflly reverted. If not by Rambling Man, by any other admin or even non-admin that would have stumbled into it. I strongly suggest you move on. Move on. Keeper | 76 | Disclaimer 19:54, 17 March 2008 (UTC)
IAR only works when you're right. Also, I'd suggest on reading up on our policies about conflicts of interest, edit-warring, and what vandalism is and isn't. Throwing around acronyms without actually knowing what they mean isn't really the best way to get your point across. east.718 at 20:07, March 17, 2008
I'm sorry but I have to comment here. KoshVorlon has pointed out that mention was made (by me) that the AfD came across as if it was being done to make a point, which with respect it did. That is exactly how it looked and still looks. However, bear in mind that Kosh has also used an edit summary to make an accusation of sockpuppetry without any evidence, and has npot replied when asked to back up his claim; he has also accued me of having a "conflict of interest" without it would seem having a clear understanding of what WP:COI actually involves. I, like BlackKite, keep the article in my watchlist for the very same reasons as BlackKite, to root out POV pushing & vandalism and to also ensure it is correctly sourced, as it is a topic where there are a number of sources that are not reliable, and that can attract strong POV. The topic matter is not the most pleasant, but that is irrelevant to whether it should be on wikipedia. How exactly my comments on the AfD and my "keep" qualify as COI, I really don't know. Kosh has also accused a number of others, again including myself, of being in "a group" and claimed that therefore all our comments are irrelevant because we all apparently have a conflict of interest. This whole thing has been blown up totally out of proportion and seems as if it is being used to push Kosh's views about Lists on wikipedia. I've no idea how many "lists" there are on wikipedia but I know that there are good articles and guidelines which specify how lists should be formatted etc. There is also this list, Wikipedia:List of Wikipedians by number of edits. If all the Lists on wikipedia were put forward for AfD we would be here for a very long time.♦Tangerines♦·Talk 21:15, 17 March 2008 (UTC)

Kosh, WP:IAR only applies, not when only you're "right" as pointed out by someone above, but when the absence of your action seems to the undermine the spirit of what Wikipedia is about. In other words, you ignore all rules when a procedure prevents wikipedia from being what it's supposed to be. You went against clear consensus and closed (as delete mind you - that's a no no) an AfD that you were the nominator of. I believe this is pretty cut and dry and extend to all those people involved in the discussion to consider the matter closed. Kosh, if you continue to badger the point, you will only succeed and illuminating yourself in the bad light. Wisdom89 (T / C) 23:28, 17 March 2008 (UTC)

As one of the contributors to the discussion at Wikipedia:Articles for deletion/List of hooligan firms, and one of those who reverted the editor's unfortunate closure of his own nomination, I have to say that I see nothing wrong with the consensus at that AfD, and that it seems to pretty clearly say Keep, given that lists are allowed in Wikipedia. I mention the AfD because it is the core reason we are here today. I was on the point of posting here myself in relation to the accusing editor, but he has saved me the effort. His over-bearing need to have this list deleted has clouded his objectivity, to the point where he will use all ends to achieve it, and his conduct now borders on uncivil. Myself and fellow editors are struggling to maintain our cool and desist from sinking to insults. I am putting this in as strong a way as possible without being impolite. As far as I personally am concerned, the editor must follow the laid-down guidelines and policies put in place at AfD (and elsewhere, as this ANI is frivolous to the extreme), or risk removal from our community, for whatever length of time. Unlike the editor, I am unable to decide one way or the other on that, because I don't have the tools (I have pointed out to him his lack of the same for deleting articles he takes a dislike to). I am hoping, however, that he, as a fellow editor with much to offer us, will step back and let the AfD process take its course, then return to making solid contributions to the encyclopedia. Thanks. Ref (chew)(do) 11:03, 18 March 2008 (UTC)
Ref, say WHAT?!?!?!? Dude, why don't you read Wikipedia is not a list.

It contradicts what you just said. Bottom line here, the "article" is a list. That's just a fact. Wikipedia isn't for list, that's a fact, per WP:NOT#DIR. Yes, I closed it per BOLD and IAR and contrary to popular opinion, I was right. Policy states it as such. If I create a page about an actor and I have it referenced to the gills, but it's defaming him, it doesn't matter how many people say "KEEP". I'm violating BLP and therefore, by policy alone the article has to be deleted, consensus or not. GO back and read policy then tell me Wikipedia is for list. I'll leave the your list be. Kosh Sez We don't need no stinkin FUR!! 12:19, 18 March 2008 (UTC)

forget the list itself, you were simply WRONG to close the AFD, numerous people have told you this whatever you'd like to claim about IAR and BOLD. You can argue the toss about this all day but nobody agrees. I'll leave the your list be. this sounds like a threat to me? what is you plan to do? run another AFD? blank the page? --Fredrick day 12:23, 18 March 2008 (UTC)
Sorry, no can do. If it's a list then it fails policy. Fail policy and your "article" , list whatever, gets deleted, that's just fact. By the way, "I'll leave the list be" sounds like a threat? No way ! It means just what it says, I'll leave it alone. I won't touch it. No further action. Kosh Sez We don't need no stinkin FUR!! 12:38, 18 March 2008 (UTC)
Kosh, what part of the fact that Wikipedia allows lists do you not understand? You are seriously misreading what WP:NOT#DIR says. What it actually says is "Lists or repositories of loosely associated topics such as quotations, aphorisms, or persons (real or fictional)." It goes on to say "Of course, there is nothing wrong with having lists...". Simply being a list does not make something eligible for deletion. You also may not ever close a deletion discussion you initiated unless you have decided to withdraw the nomination, and even then it may not be appropriate if there are several editors who believe deletion is the correct course of action. Simply put, you are wrong on all accounts. - auburnpilot talk 14:52, 18 March 2008 (UTC)
Comment - "I'll leave the your list be" denotes that he still believes that I, or my fellow consensors at the particular AfD which stoked him up, actually seriously contribute to, or maybe even own, the article List of hooligan firms. For my part, I simply happened across this AfD and decided to vote as a one-off, which I do regularly on a variety of topics, and as I expect to be allowed to do peacefully, as long as I don't disrupt Wikipedia doing it. Exactly the behaviour we are viewing at the moment - but not from myself, I assure you. Thanks. Ref (chew)(do) 16:02, 18 March 2008 (UTC)

'Not a list' has the specific footnote - This provision is not intended to encompass lists of links to articles within Wikipedia that are used for internal organization or to describe a notable subject. MickMacNee (talk) 16:13, 18 March 2008 (UTC)

This has got completely out of hand. As has been poined out above, a number of editors have tried dealing with this civilly and in the face of unfounded accusations of "conflict of interest", vandalism and sock puppetry and somehow of being part of a group, all because they all disagreed with Kosh's opinion. Regardless of the consenus of the AfD, Kosh still refuses to accept that he was wrong to close the AfD despite being told that as nominator he is not allowed to close it, and especially so when he has no powers to delete the article. This should not even be an issue. Surely it is time to move on. Also, given that Kosh as nominator of the AfD has now said, "I'll leave it alone. I won't touch it. No further action." then presumably he accepts the consensus, albeit still fully disageering with it, which he is perfectly entitled to do.♦Tangerines♦·Talk 17:04, 18 March 2008 (UTC)

A new vandalism-only account?: Roosterpunk430

Left a warning. In the future, please use WP:AIV for a more direct response (remember to warn them first!). Thanks, Master of Puppets Call me MoP! 07:38, 18 March 2008 (UTC)

User:Nicolaas Smith: repeated personal attacks

I (and others) are being repeatedly attacked at the Talk:Inflation page. I am hard-pressed to place all the diffs due to the editing storm by this user:
(Note: this user is a confirmed sockpuppeter who has recently used different log-in names and frequently does not log in - see my note to him that I would only mention this if he appeared to be sockpuppeting by not logging in or using different names: Diff from talk page. In this same communication on his talk page, I also requested he stop referring to me when there is no connection. This is repeated in subsequent communications, politely; this conversation was then posted to the inflation talk page: cross-posting of info.
  1. "What is the talk page for then? Here we are suppose to state things and discuss things. If you remove it from the talk page then what is this talk page for? Are you crazy or what? Nicolaas Smith (talk) 22:10, 16 March 2008 (UTC) the sockpuppet"
  2. Accusation of censorship: :"although editor Gregalton wants to censor me..."Nicolaas Smith (talk) 15:33, 16 March 2008 (UTC)
  3. Accusations of puppetry: "Puppet Gregalton will hate the fact that I can add my knowledge to Wikipedia...Puppet Gregalton will certainly find ways to still bannish my work from Wikipedia. Nicolaas Smith (talk) 18:57, 17 March 2008 (UTC)
  4. Comparison to Mugabe: "If you do not want me to mention your self-puppet name - it is not your real name - on Wikipedia you will have to leave Wikipedia. Have you never heard about freedom of speech? You will do well in Robert Mugabe´s government. Nicolaas Smith (talk) 19:38, 16 March 2008 (UTC)"
  5. Denial of comparison in response to polite request: "I did not compare you to Robert Mugabe. I said "You will do well in Robert Mugabe´s government." Signed: Nicolaas Smith - Gregalton´s favourite sock puppeteer. —Preceding unsigned comment added by 87.103.77.114 (talk) 07:18, 17 March 2008 (UTC)"
  6. Don't even know what to say about this: "Don´t give me the story about "personal attack". Are you here in person? No. You are not here in person. You are here as a puppet of your real self. No-one knows who you are. I am here as myself, Nicolaas Smith. I am not a puppet. You are the puppet. I can attack your puppet, if I want to - and bear the consequences. I did not compare the puppet Gregalton to Robert Mugabe. I said that the puppet Gregalton will do well in Robert Mugabe´s government. The real person who uses the puppet name Gregalton will most probably behave differently when not hiding behind the anonymity provided by the puppet name Gregalton. It is impossible for me to attack your person. I do not know who you are. You are not here as a person but as a puppet of a person. A person who no-one knows"
  7. More of the same: "There is a difference being on here as a person in your personal name and being on Wikipedia as a puppet. You know that very well. Puppets like you have the advantage of anonymity. You have already abused that advantage in the past with attacks against me personally or against my puppet self when I was on here as a puppet (not a sockpuppet) - I can´t remember whether you attacked my puppet self of me personnally. I will not waste time to check. I do remember it happened."
  8. General rudeness: "It is absolutely reprehensible and contrary to the spirit of Wikipedia that a very experienced editor like Gregalton knows about the Citing Oneself Wikipedia Policy and does not point it out to inexperienced editors like me. Nicolaas Smith (talk) 21:16, 17 March 2008 (UTC)". Since this whole bizarre history with this editor started some time ago, and he was confirmed as a sockpuppeter July 2007, hard to say inexperienced.
As further background, this editor has repeatedly attempted to push his own theory, self-published (although may have been published recently, as "truth." (See " I think the fact that I say that accounting and accountants destroy real value is what people do not want to hear. Unfortunately it is true. But, the whole world is unfolding, as it should (is that a quote from Khalil Gibran?). So why not accounting too? Not updating constant real values is a serious matter and changing that assumption will change the current Historical Cost paradigm. So, it is a big thing. That is why everybody is so much against it." and numerous others."
Grateful some attention to this, this is out of control on this one page (and this user keeps returning with editstorms every few months and then leaves in a huff, only to return more out of control).--Gregalton (talk) 07:42, 18 March 2008 (UTC)
Eh, this is messy. I think there's an unnecessary amount of animosity between you guys. I'll drop a note on Nick's talk page about civility, though the issue here is that you guys are making your differences personal. That's not the way to go. Also, if you think there's sockpuppetry going on WP:SSP might help. Given the user's history, sockpuppetry will lead to an indef block. Master of Puppets Call me MoP! 07:51, 18 March 2008 (UTC)
Thanks for your note. I think you will see from my note on the user's talk page that my interventions have been polite. It should be obvious from interactions with other editors the issue is a more general one - although the bulk of the animosity is directed at me.--Gregalton (talk) 08:02, 18 March 2008 (UTC)

Cardiff - repeated IP vandalism

The article Cardiff has been repeated vandalised by an anonymous user who persists in inserting spurious and unsourced claims, as can be seen from the article's history page. The vandal appears to be using a dynamic (probably dial-up) IP address so even though warnings have been left in the past they seem to have done no good. Therefore, could someone semi-protect this page so that only registered users can edit it? Bettia (talk) 09:32, 18 March 2008 (UTC)

Done. Cheers, Casliber (talk · contribs) 09:34, 18 March 2008 (UTC)
Thanks matey! Bettia (talk) 09:40, 18 March 2008 (UTC)

Actually, would it also be possible to semi-protect Wales as this user has also been 'active' on there as well? Bettia (talk) 09:46, 18 March 2008 (UTC)

Yup - both semi-protected for 3 months. We'll see how it goes. Happy to reprotect after that date if the shenanigans continue. There is a specific page, WP:RFPP, for requests as well :) Cheers, Casliber (talk · contribs) 09:50, 18 March 2008 (UTC)
Many thanks again. Bettia (talk) 10:05, 18 March 2008 (UTC)

TFD closure overdue

This TFD was "relisted". It is however, over 7 days old. Can someone close? http://en.wikipedia.org/wiki/Wikipedia:Templates_for_deletion/Log/2008_March_18 (irrel) NonvocalScream (talk) 09:57, 18 March 2008 (UTC)

It's sort of pointless at this point. The consensus was for delete. I was browbeaten for closing it that way. So I relisted it and suddenly we have a slew of keep votes almost at once. 10:03, 10:24 and 10:27. The main complaint of the keep side was that there was "recruiting" on an IRC channel for delete votes. Well now I think we have it going on for the keep side. I say, scrap the whole thing and start over. Obviously, we have alot of passion on both sides and a fair vote is not going to happen. I tell ya. Unless it's overwhelming on either side, XfD votes have become a major pain. --WoohookittyWoohoo! 10:45, 18 March 2008 (UTC)

my thoughts on assuming good faith. NonvocalScream (talk) 12:21, 18 March 2008 (UTC)

Today's featured article vandalism

Template:Hmbox Today's featured article contains unreverted vandalism in the first sentence. The word "Lesbian" remains as the result of this incompletely reverted vandalism edit [[14]]. Could an administrator please get on it? AKAF (talk) 10:54, 18 March 2008 (UTC)

The article looks good now, but as a point of order for the rookie admin (me) - do we full protect the main page article, or just semi unless high levels of vandalism warrant a full protection? UltraExactZZ Claims ~ Evidence 12:18, 18 March 2008 (UTC)
Semi-protect if it gets really bad and even then only for about an hour or two. Full protection shouldn't be used against vandalism. James086Talk | Email 12:21, 18 March 2008 (UTC)
As James says semi at worst, but generally the daily featured article is never protected. It's on enough peoples watchlists that vandalism will be reverted straight away. Pedro :  Chat  12:23, 18 March 2008 (UTC)

Underreporting deaths in Tibet on the Main Page

I am upset that the Main Page is saying that "at least 10" people have been killed in the unrest in Tibet, when the official Chinese government figure (which I do not believe anyone should trust) is already at 13, and the figure from the Tibetan government-in-exile is up to 99. There have been complaints about this at WP:ERRORS#Tibet Story for three days now with no action.

The Dalai Lama specifically states that he will resign if the violence continues, and that he is opposed to an Olympic boycott. Shouldn't that be included? All of the other "In the news" items are lengthier, so why not? SBPrakash (talk) 13:04, 18 March 2008 (UTC)

I am moving your question to Template talk:In the news, which is the appropriate page here. Thanks. -- lucasbfr talk 13:13, 18 March 2008 (UTC)
It says at the top of that page where you moved it, "To report errors that are currently on In the news, please post them on WP:ERRORS." The complaint, as I said, has been there at WP:ERRORS for three days without action. I am inclined to remove the archive notice here, but will ask someone else to because I'm scared of doing something against protocol that I don't know about. SBPrakash (talk) 13:17, 18 March 2008 (UTC)
You are right, my mistake. Sorry! I commented at WP:ERROR. -- lucasbfr talk 13:40, 18 March 2008 (UTC)

Single-purpose spamming account

Template:Hmbox

User:Thesnodgrass continues to add linkspam to various UK articles, despite warnings. I think a block is needed here. --RFBailey (talk) 14:04, 18 March 2008 (UTC)

Norman Bettison

Third vandalism this month to Norman Bettison: [15][16][17] Gordonofcartoon (talk) 14:35, 18 March 2008 (UTC)

Not worrisome enough to warrant a block at this time, IMHO. If the problem persists, don't hesitate to poke me on my talk page. -- lucasbfr talk 15:37, 18 March 2008 (UTC)
Agreed; there's a few admins watching the page, so if the IP gets more enthusiastic about it and edits more rapidly, someone will surely catch it. Right now, with a frequency of one edit every few days, it's not really block-worthy yet. Tony Fox (arf!) 15:51, 18 March 2008 (UTC)

Request

I would like to ask administrators intervention as I currently being harassed by particular contributor, who yesterday launch shameful campaign on my talk page (initially targeted and wrong person [18]) --- [19][20] [21][22] [23]. He/she was warned about personal attacks [24] but not stopping. May I ask sysop to additionally inform this particular person to stop this campaign and please protect my user talk page. Thank you, M.K. (talk) 14:36, 18 March 2008 (UTC)

I have left the contributor a note regarding our guidelines on harassment, particularly user space harassment. I hope that the contributor will stop restoring the message. If not, a block to prevent further disruption is preferable to protecting your user talk page, which is an important avenue to allow other contributors to contact you. --Moonriddengirl (talk) 15:09, 18 March 2008 (UTC)
Thank you for quick response, M.K. (talk) 15:10, 18 March 2008 (UTC)

User:Hornetchild16

Template:Hmbox Obvious sock of long time blocked abuser User:Hornetman16. Like the latter, Hornetchild straight away introduces himself to WP:PW (Hornetman16 regulary edited WWE articles), see here. Also see his contribs. Indef-block please. D.M.N. (talk) 17:38, 18 March 2008 (UTC)

Thanks Script error: No such module "user". for blocking him indef. D.M.N. (talk) 18:06, 18 March 2008 (UTC)

Dbachmann

The following was left on my talk page by a user in need of some help. As he says, I don't really want to get involved. I stepped in regarding a naming convention (see Wikipedia talk:Naming conventions (Syriac)‎) but I'm really trying to keep my distance from the overall issue. I'm just posting this here because I don't think Chaldean is aware of this page.

I know you don't want to get involved, but you have to, since the only admin involved is abusing his powers. He is deleting masive amount of source information [[25]] when it is clearly not off-topic. When I ask sources for his big changes, he states he owns the page [[26]] and is not obligated to bring sources to the table. I try to negotiate with, try to work with him, but he continues to put me down [[27]]. It would be one thing if this was a regular user talking this way, but this is an admin. He is moving pages without discussion [[28]] and the madness goes on. The thing I'm must troubled with is that he doesn't want to negotiate. I have been verbially abused so many times by this guy in the past week, for simply asking sources for his edits. And now he is ready to put his master-plan together by moving Assyrian people page, despite the huge opposition to it in the talk page. He doesn't care, his gameplan is to wait until the opposition has died down and then suggest to move it again. You don't go to Greek people page and suggest to move it to Greek/Hellenics people. This guy has a complete monopoly on Assyrian related pages. Chaldean (talk) 13:56, 15 March 2008 (UTC)

I know the editor who wrote this has some POV issues of his own, but I also think Dbachmann is a little over-involved in this topic and is getting kind of aggressive, as some of his edits show. A few more eyes on the matter might be useful. Thanks, everyone. Kafziel Complaint Department 06:46, 16 March 2008 (UTC)

Hmm. Yes. I don't have time myself, but this does look like it needs attention. Fast. For the record, Dbachmann is not using his tools (unless he is moving over redirects), so no abuse I can see. Just a content dispute that may be escalating. Carcharoth (talk) 09:49, 16 March 2008 (UTC)
Ri-ight. Lets examine some of the diffs, shall we? "Deleting masive amount of source information" is usually the first thing one has to do on discovering a little walled garden where enthusiasts or fringe nationalists or mysticists of some stripe or another have set up a shrine to something. In this case, Dbachmann removed a long disgression about the stone age from an article about modern names. "Ownership" - I read Dbachmann's edit summary as indicating that he knows where the page has to go, but he's being swarmed with what he assumes are extreme nationalists; I personally can't disagree. (User:Chaldean's username is a bit of a giveaway.) In the same summary Dbachmann pleads for some admin attention. So I suppose this section is useful in a way after all.
"Moving pages" - as Carcaroth has pointed, out, its over redirects. More to the point, he had a perfectly valid reason: he moved the page "X in the USA" to X's official group name in the US census.
All-in-all, business as usual. Dbachmann's trying to apply our core policies to another little-visited corner of the project, that's all. His talkpage shows him being relatively restrained with the ensuing commotion. If anyone's interested, I'm sure he'd be happy with some help. Relata refero (talk) 10:17, 16 March 2008 (UTC)

I am a little concerned with what I perceive as a growing attitude to consider editors actively trying to implement Wikipedia core policies as "over-involved". Indeed this needs more eyes. I have been advertising for more eyes. I will be grateful if it isn't left entirely to me to look after WP's coverage of "various ethnic groups and nationalisms". It is a deeply flawed attitude to think that the "admin caste" is here for admonishing people, while matters of content should be left to pov pushers of various convictions. I can't believe I am "old school" for actually trying to understand the issues under dispute and trying to fix them within policy, instead of an idiotic approach of "hur, hur, can you believe, some people are arguing over content (as opposed to procedure and red tape). Let's slap them all on the wrist a little bit and go back to Wikipedia-administring on IRC". dab (𒁳) 12:35, 16 March 2008 (UTC)

You can spend the rest of your life on IRC and you'll never see me there. I resent the implication that I'm a red tape admin; anyone here who knows me - love me or hate me - knows that isn't true. I know I stepped on your toes a bit with your guideline proposal, but that was because you were abusing it. I backed up my reasons with policy (just as you're doing here) but that doesn't mean I'm any more a slave to procedure than you are.
I'm curious, though, as to which "core policies" were implemented by this comment or this edit summary. That's the sort of thing that tells me you may be "over-involved". Kafziel Complaint Department 15:58, 16 March 2008 (UTC)
That's the sort of thing that tells me only that someone has been over-taxing even Dbachmann's abundant patience. It happens, you know. Fut.Perf. 17:00, 16 March 2008 (UTC)
It looks like Dbachmann has been violating our core policy of WP:CONDESCENSION again. Wait, that's a red link. Never mind... John Carter (talk) 16:30, 17 March 2008 (UTC)
Give me a break. If a new user had said that stuff, he'd be warned for incivility immediately. It should be more so - not less - when it's an admin. Kafziel Complaint Department 17:07, 17 March 2008 (UTC)
Doesn't look that way to me, and i'm NOT one of Dbachmann's biggest fans. I don't always agree with him, but he's out there in the middle of lots of serious POV pushing messes, and usually TRIES to go towards NPOV, though i'm not sure his NPOV matches everyone elses. That he regularly gets hit here for being a wide angle POV pusher is absurd, and that he gets tired of it at times is understandable. I don't see much wrong beyond the condescending tone, which isn't incivil, just blunt. and Wikipedia needs more blunt talk and less obsequious patter. In fact, we just had a thread about how being TOO tiptoe-y can be disruptive. ThuranX (talk) 20:35, 17 March 2008 (UTC)
Not uncivil, just blunt? It's deplorable conduct, totally unfit for this wiki. No personal attacks is policy. Further up this board an IP just got blocked for saying "You must be bloody awful to work with." Admins would do well to apply such blocks to their own caste, or not at all. Your double standards on civility bring the project into disrepute, and cause no end of ill feeling. The tone and import of Fut and Carter's responses make it difficult to dismiss perceptions such as point two here. 86.44.6.14 (talk) 23:24, 18 March 2008 (UTC)
Speaking as someone who's helped out far too little at the fringe noticeboard, it looks to me like Dbachmann is indeed showing signs that he is perhaps overworked, and only a human after all. Shall we, then, provide him with a cigarette, a blindfold, and a sunny bit of wall to stand in front of? I would hope not. Sheffield Steeltalkstalk 21:15, 17 March 2008 (UTC)
Who was I kidding. I thought I was done and made my final wiki edit. After all the verbal abuse that I have recieved from dab, I thought it really wasn't worth it anymore. Saying the things dab has said against a person that is pushing POV and is simply wrong would be one thing. But please I ask you to show me what I have done or said that made me deserve the treatment that I got. I wasn't the one that removed massive amount of sourced information, it was him. He creates his own "guideline"[29] and then try to use it to win arguments elsewhere[30]. I was simply asking (over and over again) for sources from dab. The answer that I kept on getting was verbal abuse with the declaration of me not having good enough English skills to work with him. Funny that I have been working on Wiki for 2 years contributed over 10,000 edits and not one other user has accused me of having bad English langauge skills. Chaldean (talk) 15:50, 18 March 2008 (UTC)
I try to work with dab and let me give you an example of what I get from him whenever I do so;
Chaldean - - there are other ternomologies for every single ethnic group. Show me another ethnic group page on Wikipedia that uses /. By your idiology, we should move the Greek people page to Greek/Hellenic people. Again, you continue to create more problems then actually slove them. I awknolged there is an issue and that is why we created the naming disupte page. But to spill this issue on all these other pages is making things ever worse. [31]
Dab's answer - except the Greeks don't make fools of themselves in the Greek/Hellenic matter the way you people do. [32]
How is an admin to talk in his tone and let it be ok? Do rules still apply on admins? If he said what he said about the Jews, then everyone would quickly condemn him and ask for some kind of block. Actually, a fellow Wiki friend just went throught that and made similar marks, but were anti-semetic (User:EliasAlucard). Chaldean (talk) 19:40, 18 March 2008 (UTC)

Reporting user for continued Wikipedia disturbance, including repeated sock puppetry

I, Template:User-multi am reporting Template:User-multi for repeated sock puppetry use during edit wars and continued disruption of the editing process. (Please forgive the length of this entry - I just wanted to make sure I thoroughly documented the sock puppetry.)

Previous incidents:

Incidents not yet reported:

  • Of Kilz's approximately 1,200 edits, about 1,100 - over 90% - are related to controversy he has stirred up in the following 3 articles:
  • I have identified 4 sock puppets which Kilz uses to make edits during these edit wars, and to agree with his arguments in discussion pages:
  • Use of Loki144:
  • Kilz argues for the removal of a reference for benchmark data which shows Swiftfox is faster than Firefox:
  • "The site is also a private site listing the findings of only one person with no editorial oversight and is therefore not a creditable source [WP:RS]..." (diff: [36])
  • Loki44 backs Kilz up:
  • "The browser speed test site is also a private site and not a reliable source." (diff: [37])
  • Use of IDontBelieveYou:
  • When Kilz argued for the removal of the reference for benchmark data, he also said:
  • "If we cant find information on the 2.0 version from a reliable source the section needs to be removed IMHO." (same diff as above: [38])
  • IDontBelieveYou backs Kilz up:
  • "I agree with you Kilz... This article should be about 2.0. If we can't find references for the speed section for 2.0, the section should be removed." (diff: [39])
  • Kilz doesn't believe Swiftfox is faster than Firefox.
  • Kilz removes the text "The name Swiftfox implies a faster browser than Firefox" (diff [40]). It gets added back in. Kilz then adds a {{fact}} tag (diff [41]). It gets removed. Kilz adds an {{unreliable}} tag to the section instead (diff [42]). It gets removed. He adds it again (diff [43]). It gets removed again.
  • IDontBelieveYou comes to Kilz's aid:
  • He makes the following edit: "The name Swiftfox comes from the animal Swift Fox which coincidently implies speed". (diff [44])
  • That edit gets removed, then Kilz "restore[s] edit of idontbelieveyou" (diff [45])
  • Use of IDBYou and StVectra:
  • "It dose not pass WP:SOURCES it is a self published source." (diff [46])
  • StVectra agrees with Kilz:
  • "Microsoft in this instance is not a reliable source. It is writing about itself WP:SELFPUB clearly says it cant be used as a reference when it includes claims about third parties." (diff [47])
  • Kilz later responds:
  • "You cant use the source. It is self published , and has claims about a third party." (diff [48])
  • Sock pupped IDBYou backs Kilz and StVectra up:
  • "WP:VER is very clear, you can not use self published sources. I think the section needs to be removed as it also has claims against a 3rd party" (diff [49])
  • Kilz later argues that blogs cannot be used as sources:
  • "This is from a Blog, blogs are not usable as sources WP:SPS." (diff [50])
  • StVectra agrees:
  • "I agree that blogs should not be used as sources or references. They all to often have bias that is impossible to remove." (diff [51])
  • Kilz agrees with the bias point:
  • "Every blog has bias." (diff [52])
  • Kilz later disagrees with blogs I have removed:
  • "Ars Technica is a news site. That they use Groklaw as a source in no way makes them unusable. FanaticAttack is not a blog in my opinion but an news site that covers a wide range of topics. The article is neutral. That it has a place for comments is besides the point. GrokDoc is a wiki, but it is not an 'open wiki'." (diff [53])
  • StVectra agrees with Kilz:
  • "Use of information on Groklaw is not a reason to remove another site. Fanaticattack is not a blog IMHO, and the neutral style they use is that of most news sites. I am not so sure about Grokdoc more because of a neutral point of view problem. Open wiki's are those that allow anon posting, it is not open." (diff [54])
  • Kilz removes information (diff [55]) that later gets restored. IDBYou removes the same information (diff [56]).
  • IDBYou removes some quotations from the same section (diff [57]) that are later restored. Kilz removes some of them again (diff [58]).

Kilz's periods of editing activity - whether via sock puppets or his logged in account - are directly correlated to edit wars and controversy within those articles.

  • Swiftfox: This dispute was summed up here. Kilz believes Swiftfox is non-Free Software and is opposed to non-Free Software: "There are a few of us on the Ubuntu forums who oppose non free software... Jason has tried to stop me from telling people Swiftfox is non-free... I think I know how unethical he is, and know he will lie to win." (diff: diff).
  • Office Open XML and Standardization of Office Open XML: On Kilz's talk page, "Groklaw - I find the site facinating. When I found it 2 1/2 years ago I was still using Windows. The site has changed how I feel about freedom and the court system. Ubuntu - I have completely removed Microsoft from my life. I do not miss it in any way." (diff: [59]) Groklaw is critical of Office Open XML standardization.

While every editor has a point of view, Kilz is extremely and continuously disruptive.

If necessary, I can provide more info on request.

Thanks, WalterGR (talk | contributions) 10:15, 16 March 2008 (UTC)

Kilz may also be using the Tor (anonymity network) to make untraceable anonymous edits during edit wars. I can provide diffs if desired. WalterGR (talk | contributions) 01:15, 17 March 2008 (UTC)
Restoring unresolved section archived by MiszaBot II. WalterGR (talk | contributions) 06:41, 18 March 2008 (UTC)
Your best bet is WP:SSP. ColdmachineTalk 09:47, 18 March 2008 (UTC)
It was suggested I come here given the past violations of this account, the ongoing sock puppetry, the use of TOR during edit wars, and continued disruption. But if WP:SSP still really is the best place to post this, then I'll go there. Let me know. Thanks, WalterGR (talk | contributions) 16:37, 18 March 2008 (UTC)
  • Why not just copy this whole mess above to WP:RFCU? It seems like you could probably skip SSP in this case, there is already a fairly good body of evidence for a checkuser to use to evaluate whether abusive sockpuppetry has occurred. Avruch T 21:51, 18 March 2008 (UTC)
Well, based on my reading of RFCU, the only "acceptable request" would be under the category of "Request doesn't fit any of the criteria but you believe a check is warranted anyway". I think the behavioral evidence I presented above is strong enough that a checkuser isn't really needed.
I copied this report to Wikipedia:Suspected_sock_puppets and will see what happens.
Thanks for your input. I guess the report here can be marked as resolved, or whatever the proper procedure is. Thanks, WalterGR (talk | contributions) 23:07, 18 March 2008 (UTC)
Because he doesn't want that, it would clear my name. He wants to harass me and trash my name as much as possible. The only thing all the names above have in common is that they agreed with me, or did an edit like one I did before. As he already read the first sham sockpuppet case, he knows I have a static Ip. In 2006 some admin said I had a sockpuppet for a not logged in edit, read the talk page of the 2006 case above. He hopes history will repeat itself and Ill be found guilty with no evidence.
WalterGR stalks me, if I ask a question on a noticeboard, he looks up in my contribs and barges in disrupting my questions.
I even tried to put an end to the fighting, but he wasnt willing to end it. He has dredged up an argument in 2006 (Swiftfox) on a article he wasnt even involved in and one from 2008 (OOXML) and says its a pattern. Kilz (talk) 04:05, 19 March 2008 (UTC)

Haplogroup I1a (Y-DNA)

Script error: No such module "user". is a newbie here, but knows a lot about the population genetics of Haplogroup I1a (Y-DNA). Over the last two days he's substantially upgraded the article, significantly for prose style, but also adding a lot more content.

Without discussing it either on the article's talk page, or Aaron's own page, User:Olly150 executed a sweeping revert at 11:53 GMT, [63].

Then, when Aaron quietly continued adding accurate technical details about the mutations which characterise the haplogroup, User:Steve Crossin slammed him with four reverts and vandalism warnings on his talk page, following which Aaron was blocked by User:Kralizec!.

Not suprisingly, Aaron is considerably annoyed, and as of this moment isn't sure he wants anything more to do with Wikipedia.

Can we get him a speedy unblock, please? Jheald (talk) 12:41, 18 March 2008 (UTC)

While this edit doesn't seem particularly helpful, I'm seeing a lot of apparently good-faith additions to the article in question. Let me look into this. UltraExactZZ Claims ~ Evidence 12:48, 18 March 2008 (UTC)
I've left a notice for each of the involved parties (Olly, Steve Crossin, and Kralizec!), notifying them of this thread. I am inclined to unblock, but will wait a tic in the absence of discussion with/from Kralizec!. UltraExactZZ Claims ~ Evidence 13:03, 18 March 2008 (UTC)
No unblock is necessary, as the block expired 11 minutes before Jheald`s first message on my talk page. Despite the four levels of warnings given by Script error: No such module "user". (and regardless of edits like this that clearly are vandalism), I was not entirely convinced as to the merit of Steve Crossin`s block request, so I only gave Script error: No such module "user". a 15 minute block. --Kralizec! (talk) 13:08, 18 March 2008 (UTC)
Aaron's annoyance is perhaps understandable, but Aaron's communication skills could evidently use some work. Perhaps this would have been avoided if he'd taken a minute to explain in response to the warnings what he was doing rather than choosing this route to respond. I think Aaron could do with a friendly pointer to WP:AGF and WP:CIVIL and a suggestion that he try engaging the individual next time instead of vandalizing his userpage. --Moonriddengirl (talk) 13:14, 18 March 2008 (UTC)
Friendly pointer so delivered. I do commend those who've left friendly notes apologizing and/or explaining on the user's talk page. Nice anti-biting and showing of good faith, in spite of the user-space edit. :) I hope the new user won't be discouraged won't be discouraged from continuing, but will also respond more directly should there be an unfortunate next time. --Moonriddengirl (talk) 13:35, 18 March 2008 (UTC)

Since then, I have apologised to the user in question, and striked out the warnings, this is something I am deeply sorry about, and I again offer my apologies. Steve Crossin (talk) 13:13, 18 March 2008 (UTC)

I also struck the block message and apologized. --Kralizec! (talk) 13:22, 18 March 2008 (UTC)
I have left my apology on Aarons page and an explanation on Jheald's page also. Same reason as Steve - on vandalism patrol, the page came up on Lupin's AV, notably Line 380 - :Forward 5′→ 3′: gcaacaatgagggtttttttg - immediate reaction was too revert. If I had seen the page come up again, I would have looked into the history. I come accross vandalism like that all the time. Olly150 13:27, 18 March 2008 (UTC)
Good on both Steve and Olly for responding so quickly, and on Kralizec! for striking the block template. Is there any un-reverting that needs to be done at the DNA article? UltraExactZZ Claims ~ Evidence 13:43, 18 March 2008 (UTC)
Looks like Jheald reverted [64] the article immediately after his initial post here, and Aaronjhill has made over a dozen new edits [65] to the article. --Kralizec! (talk) 15:02, 18 March 2008 (UTC)
I am tempted to say something smarmy about anyone who thinks that gcaacaatgagggtttttttg in an article about DNA is vandalism. Let me say instead that automated tools that alert one to potential vandalism are merely tools, and the edits need to be viewed in context. Acting on the advice of a script or bot without checking is irresponsible. Thatcher 16:55, 18 March 2008 (UTC)
No harm meant here Thatcher, but I'm not a DNA expert. Far from it actually. However, we are glad of people like Aaron who do seem to be experts in this field. I am constantly reverting vandalism and edits that look that (see previous comment) are very common, and seem very popular amongst vandals. So I'm very sorry that I know little about DNA. And I did bring up a quick preview of the edit, as is possible thanks to Lupin, and to someone who doesn't understand such fields, it did look like vandalism. But, I promise in future to look REALLY closely at vandalism and hey, I've learnt something new. Isn't that what Wikipedia s' all about? Olly150 00:31, 19 March 2008 (UTC)

The Comparison_of_CECB_units article is uneditable

There is a small group of persons "policing" that article. They refuse to allow other persons (like myself) to edit the article. Everytime someone tries, they immediately revert the change. Is that behavior appropriate or not? ---- Theaveng (talk) 13:21, 18 March 2008 (UTC)

Maybe they have problems with the specific changes you're making, rather than with an outside person changing it as you seem to imply. —Random832 14:12, 18 March 2008 (UTC)
Yup, you can't be in the majority all the time, I see no reason to suspect foul play here. -- lucasbfr talk 15:34, 18 March 2008 (UTC)
You might get better results, Theaveng, if you do these things, some of which you may be doing already: (these are suggestions) you can talk more politely, for example avoiding saying things like "worthless" about some aspect of the article which no doubt someone else has expended work on; you can avoid using a lot of bold type, which may make you look angry; you can try to appear calm; you can apologize for your previous tone; you can present calm, logical arguments in favour of your changes rather than complaining that the article is uneditable; you can listen to others' point of view and say things that demonstrate that you understand it; you can present your suggested changes on the talk page before editing and discuss them and only implement them if they seem to have consensus. The others are not required to allow changes that they disagree with, but they should provide explanations for the reasons they oppose those changes. --Coppertwig (talk) 17:25, 18 March 2008 (UTC)
I've notified Wikiproject Telecommunications in an attempt to bring more eyes, in any case. —Random832 19:46, 18 March 2008 (UTC)

Vandalism

The article Cone sisters is being vandalized by a group of related IP addresses. Can someone please look at the pattern of ip addresses being used. Wanderer57 (talk) 21:03, 18 March 2008 (UTC)


Activity and anons suggest a single individual with a dynamic IP. I would revert block ignore for now. If it gets really disruptive, request semi protection at WP:RFPP. Wisdom89 (T / C) 21:09, 18 March 2008 (UTC)
They all resolve to the Palo Alto School District, and based on this, probably to Gunn High School. Corvus cornixtalk 21:38, 18 March 2008 (UTC)

Vandalism to Random Archive Pages

Some random IPs (all different) are going around to archived pages replacing content with "(random characters) Cool bro" (example and another example). I'm not sure whether this is a coincidence or what? --EoL talk 21:21, 18 March 2008 (UTC)

I've just encountered three anonymous users vandalizing users' Talk pages and, in particular, users' Talk page archives, replacing the content with a random string of characters followed by "cool, bro!" They all resolve to AT&T, and they keep changing IPs rapidly, so rapidly, in fact, that two edits in the Recent changes were back to back vandalisms in the same vein by different editors, which makes me wonder if this is some sort of coordinated attack, or else some amazingly fast address jumping. The three I've encountered so far are: Template:User-multi, Template:User-multi and Template:User-multi. Corvus cornixtalk 21:25, 18 March 2008 (UTC) ‎

My money's on coordinated attack given the timing you state above. -Jéské (v^_^v Detarder) 21:26, 18 March 2008 (UTC)
Same vandalism from this one Template:User-multi now blocked.— Ѕandahl 21:32, 18 March 2008 (UTC)
They're now moving on to other types of archives - [66]. Corvus cornixtalk 21:28, 18 March 2008 (UTC)
Just struck again on recent changes, [67]. AndreNatas (talk) 21:29, 18 March 2008 (UTC)
I've noticed this, too (apparent from the ANI post I made just before yours). They'll get tired eventually (I hope). Until then, I'll rollback whatever I can. --EoL talk 21:29, 18 March 2008 (UTC)
There's been a considerable increase in open proxy spambot and vandalbot activity such as this in the past few days. They are mostly zombies. Look out for "nice site!"[68] too. -- zzuuzz (talk) 21:31, 18 March 2008 (UTC)
Also 24.47.55.108 (talk · contribs · deleted contribs · page moves · block user · block log) who I just warned before seeing this on ANI, should we block them instead? Georgewilliamherbert (talk) 21:33, 18 March 2008 (UTC)
I would say block them immediately, for how long is a matter of opinion. -- zzuuzz (talk) 21:36, 18 March 2008 (UTC)
You could probably get away with a year-block as a Template:Tl. --EoL talk 21:55, 18 March 2008 (UTC)
On that note, how do we know they're zombies, and not misconfigured or regular open proxies? Nwwaew (Talk Page) (Contribs) (E-mail me) 01:57, 19 March 2008 (UTC)

Soccermeko, one more time

Template:Hmbox Judging from Nicolewrayeditor's contributions, it's probably time for a preemptive strike (or at least careful monitoring. Methinks he doth protest too much.Kww (talk) 00:10, 19 March 2008 (UTC)

Yeah, it's Soccermeko. Rule number one of sockpuppet accounts: Don't make your FIRST edit ever a denial that you are a sock puppet. Don't deny crimes you aren't accused of... Jeesh. They have been duly blocked... --Jayron32.talk.contribs 00:31, 19 March 2008 (UTC)

USS Potato Salad and other vandalisms.

I know a few people at my college that have taken upon themselves to vandalize the Potato Salad article with nonsense about a fictional ship they found online, which I corrected: [69]. Someone reverted my edit, and I re-reverted it: [70]. After I reverted the article the first time, Matt vandalized my user and usertalk pages: [71] and [72]. I yelled at him about it, in person a few minutes ago, but I doubt he will stop. I also just left a message on his talk page about it: [73]. And I am 100% sure that the IP address 68.13.207.235 is not a sock of Matt's. He/she probably just thought that I had wrongly reverted a good edit. Also, Matt lives in Virginia (like the rest of us), while the IP is from Georgia. Take that back, he also is from Virginia, based upon a different IP locater, but not from the college. He/She probably isn't involved. Perhaps the admins can do something about it, as I don't want to get caught by 3RR.

And the "threat to punish" is nothing serious. He had a twinkle in his eye when we talked. Rebelyell2006 (talk) 00:25, 19 March 2008 (UTC)

Forgot to mention that it was also added to the List of mine warfare vessels of the United States: [74]. Rebelyell2006 (talk) 00:30, 19 March 2008 (UTC)
You will never be "caught" by 3RR for removing vandalism. If you're in doubt then take it to the talk page, but here there really is no doubt. All Wikipedians should remove with extreme prejudice any content that is purely fiction, or made in bad faith to deceive readers. --PeruvianLlama(spit) 01:28, 19 March 2008 (UTC)

Infinite block of Majorly by East718

All useful discussion now on appropriate talk page; no need to further propagate needless wikidrama. —Kurykh 03:10, 19 March 2008 (UTC)


Rampant pagemove vandalism

Can administrators please help urgently repair this? скоморохъ 02:15, 19 March 2008 (UTC)

That really calls into question the reason for unblocking Script error: No such module "user". January 15, 2007; there's got to be a story behind that, no? Sarcasticidealist (talk) 02:22, 19 March 2008 (UTC)
Oh, never mind - different users. Sarcasticidealist (talk) 02:23, 19 March 2008 (UTC)
Huh? No, looks like you were right the first time. Seand59 was unblocked and recently became Script error: No such module "user".. Compromised account perhaps? —Wknight94 (talk) 02:25, 19 March 2008 (UTC)
Oh, I see now too. User was renamed and then Grawp took the old username. Odd. —Wknight94 (talk) 02:27, 19 March 2008 (UTC)
"19:57, January 15, 2007 User:Danny unblocked User:Seand59 ‎ (really foundation staff)"
apparently...скоморохъ 02:29, 19 March 2008 (UTC)
After a rename, the block log stays with the old name. —Wknight94 (talk) 02:34, 19 March 2008 (UTC)
Actually, there is a bug that prevents block logs moving during renaming and renames are generally not performed where this will lead to that information being lost. Tiptoety talk 04:23, 19 March 2008 (UTC)

Can the edit history be redacted to take out the link to the website on each edit? Nate (chatter) 02:33, 19 March 2008 (UTC)

Probably not worth it. Grawp would do this constantly if we went to that much trouble. —Wknight94 (talk) 02:34, 19 March 2008 (UTC)
I would assume this site is at the very least blacklisted though? Nate (chatter) 02:38, 19 March 2008 (UTC)
It is. Mr.Z-man 03:23, 19 March 2008 (UTC)

Relentless spammer

Posting here because this might be too complex for AIV or speedy deletion...Script error: No such module "user". is a single purpose account who has done nothing but add spam about himself and the websites/organizations he has created. The affected articles are Tucson, Arizona Community Organizations, Heptagram, Decriminalization of non-medical marijuana in the United States, List of people from Tucson, Arizona, Video game culture, and essentially every other page in his edit history. He recently created a page on himself, Joshua Jude Chesser. He was even blocked in october for spamming, but that was overturned after he claimed he wasn't aware of policy. I'd presume he understands it now, and he's even using an army of IPs to add spam about himself, I think it's about time he got blocked with severe prejudice, and the article about himself deleted. Someguy1221 (talk) 04:33, 19 March 2008 (UTC)

I've blocked indef. on the basis of spamming numerous articles with his biographical information and that of his "company", and for abusing varying IP addresses after I had given him notice previously of such infraction. seicer | talk | contribs 06:18, 19 March 2008 (UTC)

You silly people. What will you do, when I'm Mayor? Will you disregard current events then, as you do non-profit community organizations now. I speak for Tucson.

Joshua Jude Chesser President of Tucson Central Office

Allegations of State terrorism by critics of the United States

Page move? --Goon Noot (talk) 12:16, 17 March 2008 (UTC)

I can find no discussion on a proposed page move at either the talkpage of the article or Requested Moves. THe moving editor's contribs (see also Script error: No such module "user".) show no participation in such a debate, and this is the second time the editor has moved this article to a different title (per his move log, see 12 July 2007). Unless someone has an overwhelming argument for keeping the new title, either during a discussion on the matter or because it's better in some way I'm not seeing, I'll move it back. UltraExactZZ Claims ~ Evidence 12:30, 17 March 2008 (UTC)
  • MOved back. There was no discussion I can see, and this is a high traffic article so discussion is definitely needed before a move to a title which embodies a value judgement. Guy (Help!) 14:23, 17 March 2008 (UTC)
If moved again without consensus, perhaps it should be move-protected until such a consensus is reached. I'm not a fan of protecting an article in this manner but, given that this user has already moved the article twice without any involvement in the article, a third move is likely. - 52 Pickup (deal) 14:28, 17 March 2008 (UTC)
The issue of renaming this article has been discussed at length, as shown in the talk page archives here. Note that that archive is at the wrong title, but I'm not going to move it back until this settles down. My concern was that, whatever the consensus for or against the move, the article was moved and has been at a title for almost two months. If indeed consensus was strongly against this title, then someone would have moved it back sooner. The proper course would be to post on the talk page, asking about moving it back and citing the weak or missing consensus to move in the first place. Given that so much discussion had taken place about this article's title, it's unreasonable to move it without at least asking about it first. JzG was exactly right to move the article back - had I not been sidetracked, I would have done so myself. UltraExactZZ Claims ~ Evidence 16:44, 17 March 2008 (UTC)
The article was moved to it's current title unilaterally and against consensus anyways. The only reason it wasn't moved back to "Allegations of state terrorim" etc etc is because it's not possible to move to an existing page. Jtrainor (talk) 02:08, 18 March 2008 (UTC)
What a mess...that article is hopeless.--MONGO 07:36, 18 March 2008 (UTC)
Good luck getting it AfDed :x The time I tried a while back, a zillion people came out of the woodwork and accused me of all kinds of garbage. Jtrainor (talk) 21:49, 18 March 2008 (UTC)

I moved it per WP:BRD. My previous move was to restore "allegations" in the title when it was removed without consensus previously. The current title is the result of a non-consensus move. The article is unsalvageable and should be deleted. At hte very minimum, the title should be rolled back to include "allegations". --DHeyward (talk) 07:28, 19 March 2008 (UTC)

Repeated article blanking at Thought Adjuster and other articles

Template:Hmbox I reported this to the vandalism noticeboard but was advised it should go here:

User:ScienceApologist has repeatedly blanked a series of articles now despite being warned multiple times that WP:DELETE is being violated. The pages are a series of daughter articles related to a somewhat minor religion, which the editor personally doesn't seem to like. See the edit histories of articles like Thought Adjuster and Cosmology (The Urantia Book) (here and here). Both of which survived AfDs that the user has decided to override by page blanking. See also the discussion at Wikipedia:Fringe_theories/Noticeboard#Universe_reality_and_other_The_Urantia_Book_related_articles and the user's talk page, as well as my own. Wazronk (talk) 16:12, 18 March 2008 (UTC)

Thought Adjuster could stand as a monument to unreferenced soapboxing pontification everywhere. Its continued existence shows that the WP:AFD process is badly broken. Raymond Arritt (talk) 17:35, 18 March 2008 (UTC)
(ec)Both Thought Adjuster and Cosmology (The Urantia Book) should be redirects to The Urantia Book. They're completely unsupported by any independent secondary sources, and there's no reason they can't be covered in the parent article. The resulting walled garden is appropriately dealt with by redirecting them and merging relevant content - doing so is not "vandalism". Personally, I think the entire Urantia Book article ought to be evaluated at AfD as lacking in evidence of notability, but then I'm a mean deletionist. MastCell Talk 17:44, 18 March 2008 (UTC)
Entirely not true, there are numerous secondary sources, and they have been added to the references section, since they were requested. There is a claim that there is some kind of "walled garden" when in fact repeatedly editors have been invited to discuss their concerns on the talk page, but they've instead chosen to blank articles. You haven't even tried to look up sources, engage in the matter with editors, or worked to improve the articles you want to somehow pretend are "walled" off. Wazronk (talk) 18:31, 18 March 2008 (UTC)
User:Wazronk is invited to contribute to the main article The Urantia Book where some decent editing could be used. Forking guidelines are clear as to how one should fork articles, and the creation of the collection of a Urantia Book-related walled garden is inappropriate especially with single person accounts watching these articles so closely. I was responding, in point of fact, to a request on the fringe theory board which was properly filed and well-documented. Please direct further inquiries to Talk:The Urantia Book#Work on this article first.
Also note that User:Mangojuice falsely claimed in an edit summary that there were secondary sources for Thought Adjuster when in fact there are not.
ScienceApologist (talk) 17:45, 18 March 2008 (UTC)
A number of administrators including User:Skomorokh and User:Mangojuice seem content to revert in the face of the above consensus and apparently not wishing to research the issue carefully. Please, administrators, do a little research before wielding a big stick in an misinformed way. It would be nice to see them actually comment before acting. ScienceApologist (talk) 17:58, 18 March 2008 (UTC)
I did a "little research." This is a topic within the (admittedly strange and obscure) Urantia world view that is documented in quite a number of books. See [75]; particularly, note the Larson book which is, partly, an encyclopedia of religions. In any case, you do not simply edit war your way to a redirected article. You've put the article in a redirected state about 6 times in the past few days. Mangojuicetalk 18:14, 18 March 2008 (UTC)
You seem to not be paying attention. Whether the topic is mentioned in certain books in relation to explaining Urantia beliefs is irrelevant: there is neither a connection to these books in the actual article content nor is there any indication that this topic is properly forked from the main topic. Please understand that you yourself are edit warring, and the fact is that there is consensus that these articles should be redirected to The Urantia Book means (irnoically) that it is you who are edit warring in oder to defy consensus at this point. That's some pretty bad precedent you are setting as an administrator. ScienceApologist (talk) 18:32, 18 March 2008 (UTC)
There has not been a consensus and blanking articles is a violation of policy at WP:DELETE. In fact there are extensive discussions in the past that led to the branching into daughter articles but you've been so intent on blanking and reverts that you haven't even stopped to discuss it with the editors who know the history of the articles in question. Wazronk (talk) 18:44, 18 March 2008 (UTC)
The discussion between the two true-believers in The Urantia Book is meant to be binding here? No, we have the FTN discussion that shows clearly that these articles are inappropriately "branched". ScienceApologist (talk) 19:02, 18 March 2008 (UTC)
If you, ScienceApologist, were to do a little research of your own, you might find that I am not, nor have I ever been an administrator. Regardless of the merits of your intentions, your methods are completely unacceptable; WP:FRINGE is no excuse to flout consensus. скоморохъ 18:27, 18 March 2008 (UTC)
I guess it's okay when you are an administrator to throw out WP:AGF completely? I've done FAR MORE RESEARCH on this subject than you. My methods are no more "unacceptable" than your response in kind. Get over yourself: read the consensus that is achieved and add to the conversation or kindly stop acting as an obstructionist.
I agree with your sentiment SA, and how you are carrying them out is akin to petty vandalism. I am not clear how redirecting though blanking the page isn't vandalism? Whether or not the articles deserve to stay, they are here now. Blanking and redirecting, without concensus is not the way. Nominate them for Afd, and I'll vote for a redirect. Hohohahaha (talk) 18:29, 18 March 2008 (UTC)
Have I known you in a previous incarnation? ScienceApologist (talk) 18:59, 18 March 2008 (UTC)
me too. --Fredrick day 18:31, 18 March 2008 (UTC)
The point is that there is consensus demonstrated both here and at WP:FTN. ScienceApologist (talk) 18:32, 18 March 2008 (UTC)
FTN is not the place to create consensus, and.... I don't see a consensus here. I suggest that instead of redirecting the talk pages of these articles, you actually use them. Hohohahaha (talk) 18:34, 18 March 2008 (UTC)
What, in your humble estimation, the flip is FTN for if not to get consensus on issues related to fringe theories? 18:59, 18 March 2008 (UTC)
There absolutely has not been consensus as is being pretended. Wazronk (talk) 18:38, 18 March 2008 (UTC)
We know you own the content. Your ideas are weighted appropriately.ScienceApologist (talk) 18:59, 18 March 2008 (UTC)
SA, can you point out the specific thread where consensus was obtained? Thanks, seicer | talk | contribs 18:40, 18 March 2008 (UTC)
The FTN thread is fairly obvious. Anyway, it's a moot point. ScienceApologist (talk) 18:59, 18 March 2008 (UTC)

← Perhaps the most appropriate approach would be (as mentioned above) to nominate these via AfD and gauge consensus for deletion/redirect/fork articles that way. Even if a consensus exists on the fringe theories noticeboard, it would be a bit of a stretch to apply that without evidence of a similar discussion/consensus on the article talk pages. AfD is also a more "neutral" venue than the Fringe Theories board. MastCell Talk 18:44, 18 March 2008 (UTC)

I have followed MastCell's advice thus making this report irrelevant. Please continue the discussion here: Wikipedia:Articles for deletion/The Urantia Book related articles.
Please do note, though, that this kind of politicking is ridiculous. It's patently obvious that these articles are shitty excuses for content. Everyone who takes more than a passing glance at them (except the authors) agrees. Whatever. I'll let the administrators get back to their other power trips. ScienceApologist (talk) 18:56, 18 March 2008 (UTC)
Agreed. This is a walled garden, and Wazronk is a single-purpose account. But we can fix that, with a little effort. Guy (Help!) 13:36, 19 March 2008 (UTC)

User:In the Stacks repeatedly re-inserting links against consensus

User:In the Stacks has, over the course of the past six months, repeatedly added/restored a collection of links to the CrimethInc. article. I removed them, originally because they directly concerned sub-topics of the article, and later because I had integrated the reliable sources among them as references. Despite their presence as references, his reversion by three different editors, the opinion of three other editors on the talkpage that the inclusion of the links was not an improvement to the article, User:In the Stacks has continued to re-insert them. Attempts by myself and User:Murderbike to resolve the matter on the user's talkpage were unsuccessful. Neither of us want to continue reverting User:In the Stacks, so is there anything else that can be done? See the article's talk archive at Talk:CrimethInc./archive1 for a long history of the dispute. Thanks, скоморохъ 18:18, 18 March 2008 (UTC)

I'd like to add that a total of six users have expressed the opinion that the external links section should not remain, while In the Stacks stands alone in the opinion that it should stay. Murderbike (talk) 18:33, 18 March 2008 (UTC)

Context: CrimethInc. is an anarchist publisher, the disputed links were reviews of books published by CrimethInc. already present on the individual book articles (namely Recipes for Disaster). In The Stacks' contributions appear to be mostly edit-warring or discussion about edit wars. For disclosure, the three users who reverted User:In the Stacks are all members of the Anarchism task force). The CrimethInc. article was awarded GA status in the past few days, after which In The Stacks again added the links. скоморохъ 18:18, 18 March 2008 (UTC)

I'm a bit worried that my assessment of the article as stable may have been premature, but if this is just one user acting against consensus, I don't think it's much of a problem. At any rate, have the rest of the steps in dispute resolution been tried? A request for comment on the article (maybe even on the user's conduct) may be in order. --clpo13(talk) 18:48, 18 March 2008 (UTC)
I chose here rather than a request for comment because that seems like an overreaction; this dispute is rather silly, the editor is fighting a one-man battle trying to duplicate quoted references as external links. I was hoping if a posse of non-anarchism-related editors pointed out to the editor that he was acting against policy and ask him nicely to stop, we would not need to resort to formal mediation, topic blocks etc. I don't think your "stability" assessment is premature; as you allude to, a 1 vs 6 dispute about a fraction of the article's content is not a serious cause for concern. Thanks for weighing in, скоморохъ 18:58, 18 March 2008 (UTC)

Please, could any experienced editors offer advice? This issue has already fallen on deaf WP:EARS. Thanks, скоморохъ 12:47, 19 March 2008 (UTC)

Potential COI / sockpuppets / meatpuppets again at American Apparel

For the past week I've been dealing with likely WP:SOCK, WP:MEAT, and/or WP:COI editors over at the American Apparel and Dov Charney articles. Without more I can't prove it, but it looks like it may be American Apparel officials (or people meatpuppetting for their cause) trying to game Wikipedia again.

The problem started in November when a company PR person editing as User:Leftcoastbreakdown manipulated the articles to add fluff and downplay controversy (see the old AN/I incident here) The editor was warned and went away, and things were quiet until March 11 when a cadre of editors showed up to slant the article again with the same goals and tactics. The COI and SOCK editing is a problem in its own right. On the substance they've been inserting unverified material, edit warring while refusing to discuss on the talk page, making BLP attacks on the company critics, inserting and re-inserting WP:NONFREE violations, adding argumentative synthesis and analysis, etc.

I chronicled these issues at Talk:American Apparel#COI +POV watch: 6 named accounts and 9 anonymous IP editors editing in unison. Two have names matching American Apparel officials, and two made edits directly indicating they are using IP socks. All are WP:SPAs who joined Wikipedia recently to edit war on these two articles, and most are from the Los Angeles area where the company is headquartered. They're getting bolder and I can't continue without violating WP:3RR so it's time to act. Is that enough to go on or is there an intermediate step I should take before administrative action? Should I file for a WP:SSP, WP:CHECK, or WP:COIN? Thanks, Wikidemo (talk) 21:36, 18 March 2008 (UTC)

Have you discussed this at WP:COIN? Corvus cornixtalk 21:39, 18 March 2008 (UTC)
No, not yet. I was wondering where to go next. The sock/meatpuppet issue is more certain and a lot easier to prove than COIN. It's possible these editors are not officially sponsored by the company (e.g. somebody adopted the company officials' names as a hoax). Also it would be good to have a sanity check to make sure I'm not just seeing things. Wikidemo (talk) 21:49, 18 March 2008 (UTC)
A COI can't always be proved, but a pattern of promotional editing should be clear. There is an all-purpose clause in WP:COI that allows blocking for a consistent pattern of such editing:

Accounts that appear, based on their edit history, to exist for the sole or primary purpose of promoting a person, company, product, service, or organization in apparent violation of this guideline should be warned and made aware of this guideline. If the same pattern of editing continues after the warning, the account may be blocked.

In such a case you would try to get a discussion going with the editor, and if you could get no response after warnings, you might need to issue blocks. Since discussions may take time, the advantage of making a report at WP:COIN is that it would stay up for several days and you could collect some data. Here, anything is usually gone 24 hours after the last edit. EdJohnston (talk) 02:03, 19 March 2008 (UTC)

Update - an American Apparel executive has admitted that two employees have been editing the article, but denies any knowledge of any of the other meatpuppet / sockpuppet accounts.[76][77] This is stunning to me considering they did this only four months ago, and (thanks in part to me) they got off incredibly easy with nothing but a warning, at a time when companies were earning national headlines for editing their own articles. Since the COI is now confirmed it's probably time now to sort things out and clean up the mess. Not sure at what point we need to run a checkuser but that's probably the only thing that would lay to rest any questions of just how far this went. Unless anyone says otherwise I'll take this to WP:COIN as the next step. Thanks all. Wikidemo (talk) 04:21, 19 March 2008 (UTC)

This should also be examined in relation to BLP, the whole 'he's a sex perv' angle being edit-warred over probably violates our BLP standards. ThuranX (talk) 04:29, 19 March 2008 (UTC)
  • You should have first filed a request for review at WP:SSP, then filed the checkuser request and wrapped this whole thing up with a posting to COIN so that more people can monitor the page. It's obvious that it's either the same guy or a group of very closely minded people working together to insert a bias. Even without their connection to the company, they've still acknowledged that they're violating POV and said they don't intend to stop. You don't have to worry about getting permission to begin the process, this is the reason we have one. Cumulus Clouds (talk) 07:55, 19 March 2008 (UTC)
  • I can confirm the COI issues. There's an OTRS complaint that I am working on right now that concerns the bio. So please be sure that everything is sourced and that the sources are good ones. John Reaves 08:14, 19 March 2008 (UTC)

An OTRS? That would seem to belie the employees' claims that they are edit warring and sockpuppeting the article because they don't know the rules around here. Thanks for the advice and sorry for being slow on the policy - this is my first time to initiate an SSP or COIN and didn't want to make a mess of things. I've filed an SSP report at Wikipedia:Suspected sock puppets/American Apparel and also a WP:COIN report. I have no conclusion on the BLP issue. On the one hand the reports of masturbation and oral sex in the office are salacious. On the other hand they apparently did happen, they were widely reported, and are reliably sourced to sources like the New York Times and about a public figure who has unapologetically made sex the focus of his company. I'm sympathetic to the company's lament that their article does not give full coverage to all their accomplishments, but not to their attempt to subvert Wikipedia to achieve their goals of inserting PR fluff and eliminating negative material. Wikidemo (talk) 17:42, 19 March 2008 (UTC)

WP:UFA

Template:Hmbox There's a backlog if someone wants to head over that way. Gracias. AgnosticPreachersKid (talk) 10:20, 19 March 2008 (UTC)

Backlog gone. - 52 Pickup (deal) 13:27, 19 March 2008 (UTC)

Please review my block

Template:Hmbox Folks, please review my block of an IP, which has devolved onto my talk page at User_talk:Bearian#Blocking_of_User:157.228.118.212. I realise, now, that there were not 4 reverts. What should I do? Bearian (talk) 16:10, 19 March 2008 (UTC)

Unblock and move on seems about right unless I'm missing something egregious. Ronnotel (talk) 16:19, 19 March 2008 (UTC)
Is the defense "I did not revert x times" rather than "I was not edit warring"? Edit warring is harmful whether 3RR was broken or not. Friday (talk) 16:22, 19 March 2008 (UTC)
Right. I'm not entirely sure how to review this, as the 3RR report itself is malformed, and the IP has a varied edit history, which makes it harder to review for a 3RR in this case. Justin(Gmail?)(u) 16:53, 19 March 2008 (UTC)
I have unblocked the IP address, because my reasoning was wrong. He/she may have been blocked for another reason, but out of fairness, I felt I shluld unblock him/her. Bearian (talk) 17:14, 19 March 2008 (UTC)
I agree that the block should be lifted. This does not imply any criticism of the admin, or an endorsement of this IP's style of editing. The series of reverts might have been avoided if either party had tried to reach a consensus at Talk:Alexander the Great (disambiguation), but that page is still a red link as of this moment. EdJohnston (talk) 17:24, 19 March 2008 (UTC)

Dreadstar

I am having trouble with an Administrator who goes by Dreadstar. I have continuously asked him for explanations and he has only been ambiguous and pushy.--UhOhFeeling (talk) 07:46, 18 March 2008 (UTC)

Can you clarify (with diffs) what the problem is please? Cheers, Casliber (talk · contribs) 07:48, 18 March 2008 (UTC)
How do you do diffs? He insist on adding citations which I would consider incorrect. Also, he is accusing me of making personal attacks and adding fact tags to try to promote a view or something, not really sure exactly what he means and he won't really respond directly to questions.--UhOhFeeling (talk) 07:51, 18 March 2008 (UTC)
Well do you consider this a civil statement? he only noted the policy. - Caribbean~H.Q. 07:54, 18 March 2008 (UTC)
No that's not my point, really wasn't trying to be rude, just all the darth and stars and stuff, that's besides my point. Apologies...nothing wrong with being young though.--UhOhFeeling (talk) 07:57, 18 March 2008 (UTC)
See Help:Diff for information on diffs. Also, sometimes you can inadvertently push a point of view by bombing particular sections of articles with tags because you disagree with them. I'm not saying that's what you're doing, but that may be the perceived outcome. Master of Puppets Call me MoP! 07:58, 18 March 2008 (UTC)
I understand, I really just don't see how my edits could be perceived as such. I usually just add the tag to statements that sound iffy or info I though needed clarification--UhOhFeeling (talk) 08:00, 18 March 2008 (UTC)
Permit me to add my completely unsolicited 3rd party opinion, as it's late, I'm bored, and I happened to look into what UhOhFeeling is talking about. He's not drive-by tagging. He clearly was reading articles about pubs and drinking, and added {{fact}} tags in completely appropriate places.
He did his duty in questioning whether curry is a common US/Canadian pub food, because that's absolute nonsense. ("Rubbish?") I'm from the US and have traveled across it. A citation about a single restaurant in Brooklyn does not make curry a common pub food in North America.
I don't know who was being civil and who wasn't, but UhOhFeeling was not drive-by tagging.
WalterGR (talk | contributions) 08:13, 18 March 2008 (UTC)

UhOhFeeling most certainly is drive-by tagging. Three different administrators have had issues with UhOhfeeling's behavior. Also, Dreadstar tried to be informative and was met with the an insulting remark about his age, see here. As for drive-by tagging, well, make your own judgments, but several other editors complained about Uhohfeeling’s seeming over-tagging of articles. It certainly appears to me that they were correct. One article, Bhumibol Adulyadej, is an example where UhOhFeeling added a very large number of fact tags:[78][79][80][81][82][83][84] And on other articles as well: [85][86][87][88][89][90][91] As a matter of fact, out of UhOhFeeling's 51 mainspace edits, 46 of them were fact tag-related (about 90%). Anyway, several have tried to help and explain things to him, but it doesn't seem to have done much good. RlevseTalk 09:58, 18 March 2008 (UTC)

Rlevse, you're not an innocent party either. A day after he created his account, you put on his talk page: "You're trolling and I doubt you're a brand new user." and later got upset when he responded to your accusations on your talk page. (Look - I've been editing for months and I'm still not sure what the proper protocol is for talk page back-and-forths.)
In your guys' trying to help, I've only seen accusations of drive-by tagging, telling him to stop adding {{fact}}, and threatening to ban him.
Keep in mind that different people contributes to Wikipedia in different ways, according to the volunteer time they choose to donate. Having information pointed out that needs references is useful, not something to be discouraged.
So I'd say do this:
  • This all seems to be the fallout from edit wars. Let's cool down.
  • UhOhFeeling - check out {{refimprovesect}} which is documented here: Template:Refimprovesect. It's usually better to just put one of those at the top of the section, rather than several {{fact}} tags within the section.
  • Rlevse and Dreadstar: don't bite the newcomers. I didn't see anyone suggest {{refimprovesect}}.
But then again, I'm no admin. Just a 3rd party. And I should have been in bed hours ago.  :) WalterGR (talk | contributions) 10:34, 18 March 2008 (UTC)
He's not so new. He used to be User:Nigazblood. He's been talked to many times, and by more than Dreadstar and I. Tag-bombing to the point he did is counterproductive. He's had his chances. RlevseTalk 11:52, 18 March 2008 (UTC)

In my short time editing at wikipedia I have been thoroughly disappointed with the admin's quickness to judge, close-minded attitude, and lack of critical thinking. Let's look at the facts here, not how many admin's have been offended when I was following policy in the first place. I think the fact tags are useful rather than one large ambiguous tag at the top of the article they get to the point of what facts need citing. Some of the judgments cast on me as to my reasons for using fact tags are simply not true and as stated way to soon. Any advice would be appreciated, Thanks--UhOhFeeling (talk) 01:20, 19 March 2008 (UTC)

Hmm... You're right, Rlevse, he used to be another user. Perhaps I've been taken for a fool. Ah well. S'what I get for editing at 3:30 in the morning. Regardless, I've explained on his talk page what templates he should use. I'll try to keep an eye out for tag-bombing. WalterGR (talk | contributions) 19:06, 19 March 2008 (UTC)

Look at my edits people...seriously...Walter you yourself approved them until this other nonsense which has nothing to do with anything.--UhOhFeeling (talk) 03:37, 20 March 2008 (UTC)

Attempt to reveal the name of a pseudonymous editor

The conflict of interstest page asserts that "Revealing the names of pseudonymous editors is in all cases against basic policy." And yet an editor named Boodlesthecat is attempting to do just that. See this diff. Putting aside my thoughts on his assumption, inductions, and logic -- which I strongly disagree with -- isn't his attempt to publicly guess and announce my my name a violation of policy? Thanks for you comments. Gni (talk) 19:15, 18 March 2008 (UTC)

Based on the recent history, it certainly appears that you are merely hunting through EVERYTHING that Boodles has done and everything he does in the hopes of finding some sort of "impropriety" that you can make "stick". Look, stop trying to seek revenge against him because you consider him some sort of enemy. This is stalking and is wrong. Instead, return to editing articles, though I would avoid editing the CAMERA article, or any articles related to that one, as your edits there have gotten you into some trouble in the recent past. --Jayron32.talk.contribs 20:14, 18 March 2008 (UTC)
This charge is extremely unfair. I really don't think it's appropriate not to assume good faith in my edits, and it is anyway not relevant to the question of trying to out a pseudonymous editor. Nonetheless, I'll point out that I'm making an honest effort to try and improve this article in accord with Wikipedia's guidelines. I strongly disagree with Boodlesthecat's edits, just as he disagrees with mine. If anything, it seems that my changes are reflexively reverted by Boodlesthecat. —Preceding unsigned comment added by Gni (talkcontribs) 16:00, 19 March 2008 (UTC)
I was all ready to point out exactly why this doesn't violate policy, but what do you know, my addition didn't stick. I guess we have no choice but to ban Boodlesthecat. —Random832 20:40, 18 March 2008 (UTC)
I wish people would learn to handl conflict of interest suspicions sensibly. Just email info-en@wikipedia.org and ask one of the nice volunteers to sort it all out. --Anticipation of a New Lover's Arrival, The 20:48, 18 March 2008 (UTC)
If you think COI/N is not an appropriate process, where were you during the MFD? —Random832 20:49, 18 March 2008 (UTC)
What are the OTRS volunteers supposed to do about it? Mr.Z-man 16:54, 19 March 2008 (UTC)
The User talk page for every IP editor includes a WHOIS link at the bottom on which anyone can click. In this case, the WHOIS information is decisive regarding the organization from which access to Wikipedia occurred, though not about the particular individual who edited. Since Wikipedia continues to make that button available, there appears to be a consensus that it has value and should be kept. There is more information about this case at the COIN report. Personally, I would prefer that Boodlesthecat not speculate publicly in such detail about this editor's identity, but the tie connecting the IP edits (discussed more clearly at COIN) to the CAMERA organization is clear. EdJohnston (talk) 22:32, 18 March 2008 (UTC)
One thing I'd point out is that there is no wish expressed to remove the personal information, only an attempt to declare that it is against policy of Wikipedia (though CoI, 3RR, Sockpuppeting, are as well). The specifically personal information which was posted should be removed if possible, but the history of the editors suggests this is just another round of a fight rather than a concern for safety.. The concern of the editors involved should go from who can I get in trouble for violating which policy to how can I improve the overall project.. --68.23.8.245 (talk) 16:33, 19 March 2008 (UTC)
I'll gladly remove the name speculation as it seems that is proscribed. However, I did not bring this up as "another round of a fight;" there is a serious COI problem here. Gni is editing from the CAMERA offices (despite his denials of working for them and his responding to my asking about it with a personal attack). Refer to COI examples:
Accounts that appear, based on their edit history, to exist for the sole or primary purpose of promoting a person, company, product, service, or organization in apparent violation of this guideline should be warned and made aware of this guideline. If the same pattern of editing continues after the warning, the account may be blocked.
This is the salient issue here. Boodlesthecat Meow? 17:47, 19 March 2008 (UTC)
I absolutely agree to this being the salient issue. And it should be clear to neutral observers, based on my edit history, that it is hardly my sole or primary purpose to promote a person, company, product, service or organization. Let's be clear -- I do feel that CAMERA material is germane to certain articles. I do have a strong interest in Middle East issues (as does Boodlesthecat). And neither of these facts suggest a sole or primary purpose to promote anything. Now that we've heard Boodlesthecat's point of view, I very much welcome anyone else to examine my editing history. I'm confident that, while they might find support for the two points I mention in this post, they will not find support for the insinuation that I have a sole or primary purpose to promote any person, company, etc. Gni (talk) 18:10, 19 March 2008 (UTC)
This will assist in mking the determination of whether this editor, posting from CAMERA's offices, has a "sole or primary purpose to promote a person, company, product, service or organization.":
Boodlesthecat Meow? 18:24, 19 March 2008 (UTC)
User:Gni's privacy should not be unnecessarily invaded. But his protestations about not promoting Committee for Accuracy in Middle East Reporting in America don't appear convincing. The evidence already presented at WP:COIN seems to show that he (Gni) edited Wikipedia from a computer in CAMERA's offices. If you feel like addressing this further, you are welcome to offer your views in the COIN thread. The evidence for promotional editing on the articles listed at COIN is so strong that we should be warning the COI-affected editors about possible blocks if they don't desist. Coyness about personal identity sounds incongruous when it comes from the advocate of a political action group that is extremely forceful in putting its own views forward. EdJohnston (talk) 18:41, 19 March 2008 (UTC)
EdJohnston, I urge you to rethink this. I have used CAMERA material on a number occasions because I felt that this material was relevant to the article. This is hardly the same as promoting CAMERA. It is a fair source that many Wikipedians -- not only myself -- have used. It using material on multiple occasions is absolutely not the same as my diverse edits existing "for the sole or primary purpose of promoting."

I will also add that I strongly deny editing on behalf of CAMERA. If I had edited a couple times from a computer with an IP address listed as CAMERA, this in no way proves a conflict of interest. It in no way shows that I don't "place the interests of the encyclopedia first" (as per the COI page) and indeed, the history of my edits and thorough comments on various discussion pages -- even if Boodlesthecat is personally opposed to my edits -- show a consistent adherence to Wikipedia's NPOV guidelines, which seems to be the relevant and determinative factor.

Finally, Boodlesthecat seems to believe that he has the right to unilaterally ban my contributions (see this diff, even though this clearly violates the principle that "using COI allegations to gain the upper hand in a content dispute is frowned upon." Should he not desist from reverting reasonable edits, which had been discussed and argued over long before this round of disputes (including by NYScholar, who initiated this change and whose edits and discussion make quite clear that he's no cheerleader for CAMERA), by claiming COI? Especially since this issue has yet to be resolved in various COI forums? Gni (talk) 22:12, 19 March 2008 (UTC)

Script error: No such module "user".

Template:Hmbox The name of this user speaks for itself, and their userpage says, in particular: "I believe Zionism is a poisonous cancer to this world, and is the greatest obstacle to world peace. I do not like fake Muslims, who profess to be Muslim but do not reflect Islam in their behavior (hypocrites)." The contribution history reveals the following:

  • creation of a talk page section titled "Damn Shia"[92] and beginning with "The Shia are notorious for forging hadiths, making things up, passing along innovations and mixing in legends and outright lies and treating it like factual information..."
  • creation of a talk page section titled "Do the Jews own Wikipedia too?"[93]
  • addition of a statement suggesting that the United States is controlled by the Jews: "Some have suggested that the shape of these stars resembles a Jewish Star of David, which would imply a conspiracy involving Jewish control of the American government."[94]
  • repeated removal of well-sourced factual material on spurious grounds[95][96][97]

The timing of contributions suggests this account is probably a sleeper sock, but I leave it to more experienced people to suggest who might be the puppeteer. Beit Or 20:51, 18 March 2008 (UTC)

Sock or not, I think the biggest issue is whether or not the account is potentially disruptive. The username itself is on the fringe on violating policy. Wisdom89 (T / C) 21:06, 18 March 2008 (UTC)
The username and the nature of the user's contributions are such that an indefinite block is warranted. Ice Cold Beer (talk) 21:08, 18 March 2008 (UTC)
Indeed, the removal of sourced content like that warrants warnings and a report to WP:AIV anyway. Wisdom89 (T / C) 21:10, 18 March 2008 (UTC)
I have blocked him indefinitely. -Jéské (v^_^v Detarder) 21:17, 18 March 2008 (UTC)
Seconded. bibliomaniac15 Midway upon life's journey... 21:46, 18 March 2008 (UTC)
I second that as well. I asked the user to change the username way back but the user completely ignored me. --Be happy!! (talk) 00:16, 19 March 2008 (UTC)
As do I. ···日本穣? · Talk to Nihonjoe 00:27, 19 March 2008 (UTC)
Too disruptive - the name, the incivility, the trolling, the drama. I endorse the block. Bearian (talk) 00:34, 19 March 2008 (UTC)
He's starting to make unblock requests; I declined his first one as trolling (for the record, my genetic mix is Irish/German/Cherokee). -Jéské (v^_^v Detarder) 00:46, 19 March 2008 (UTC)
Has there ever been an editor who uses the phrase "baseless lies" in a non-ironic manner worth keeping around? JuJube (talk) 01:01, 19 March 2008 (UTC)
Baseless lies, check. "Jewish Wikipedia editors", check. Yup what we've got here is a conspiracy...a C-O-N...spiracy. :) Wildthing61476 (talk) 01:10, 19 March 2008 (UTC)
And second unblock request was more of the same - as well as a personal attack against Bearian thrown in for good measure. Maybe he should have followed his own holy book: "They (try to) deceive God and those who believe, yet deceive none but themselves, although they do not know./Sick are their hearts, and God adds to their malady[...]." Talkpage fully-protected, second and final unblock request declined and reverted. And for the record, I'm atheist. I simply read holy books in my spare time. -Jéské (v^_^v Detarder) 00:49, 20 March 2008 (UTC)

Sockpuppet case

User:24.127.22.57 started vandalizing Honus Wagner at 00:36. User:Boys beware was created at 00:38 and vandalized the same page at 00:41. User:David willham was created at 00:39 and joined in on the vandalism at 00:42. I blocked both accounts and the IP address (WP:DUCK, obvious sockpuppets). Things were moving so quickly that I may have messed something up and just wanted to check in here and ask if any other admins wanted to double-check my work. Useight (talk) 01:10, 19 March 2008 (UTC)

Looks 100% right to me. Good catch. ➨ REDVEЯS is a satellite and will be set alight 10:16, 19 March 2008 (UTC)
Thanks. Turns out I mistakenly blocked the IP indef when I was indef blocking the accounts, but I corrected that. Useight (talk) 21:28, 19 March 2008 (UTC)

Where is my posting?

I posted a thread here on this page on March 15 or so (I believe) entitled "Abuse by an Admin" (or some such). Where did that disappear to? Why did it disappear? And where is it? Thanks. (Joseph A. Spadaro (talk) 05:47, 19 March 2008 (UTC))

It was posted on March 15, and it was titled "Abusive Administrator". Thanks. (Joseph A. Spadaro (talk) 05:48, 19 March 2008 (UTC))
Your thread is archived here. There seemed to be a consensus that no admin abuse actually occured. Someguy1221 (talk) 05:53, 19 March 2008 (UTC)
So, an admin can manipulate policy as fits his personal agenda ... disregard the concept of consensus ... and that's not admin abuse - correct? Interesting. So, if that is not considered "abuse" by Wikipedia, ummmmm ... "standards" ... then what would constitute admin abuse? Dying to hear this one. (Joseph A. Spadaro (talk) 22:18, 19 March 2008 (UTC))
How about blocking Joseph A. Spadaro for starting this thread? That's the best example I can think of. Sheffield Steeltalkstalk 04:11, 20 March 2008 (UTC)
If you think an admin incorrectly closed an Afd, the proper venue for review is WP:DRV. Is it there? I don't see it. If you think an admin is abusing powers, the correct action is a request for comment. If the latter fails, the option for Arbitration arises. All these are set out. Whinging on outside of procedure, however strongly you feel, is not. You know your options. --Rodhullandemu (Talk) 22:30, 19 March 2008 (UTC)
Rodhullandemu is exactly correct. However, welcome as you are to investigate the possibilities of opening an RfC or going to Arbitration, you should do so under no false pretenses. The issue you brought forth was not admin abuse. It was not abuse of any variety. At best, it was a good judgement call; at worst, it was a mistake made in good faith that happened to not be in line with your own opinion on the subject. That should be the end of it. --PeruvianLlama(spit) 05:56, 20 March 2008 (UTC)

Very interesting indeed. #1. Why was I sent to this page? And, more importantly, #2 ... do you realize that this exact quote is at the top of this page: "If you want to discuss the possible misuse of administrative powers, you can do so here." Yes, I am border-line retarded (unlike you guys). So, what exactly do those quoted words mean? Help me understand, oh Great and Mighty ones. Thanks so much! You guys are great! Unreal ... (Joseph A. Spadaro (talk) 06:03, 20 March 2008 (UTC))

Coming to this page was the right thing to do. You asked what could be done about the admin abuse, and were subsequently told that it was not in fact abuse of any sort. That was the discussion: you asked, and several people chimed in to answer. If you are looking for a more long-winded approach to the situation, you are welcome to bring it up on my talk page, however the consensus here is that the matter is "closed", so it probably doesn't make sense to have any further protracted discussion on the AN/I page. --PeruvianLlama(spit) 06:16, 20 March 2008 (UTC)

User:Mikehunt11

Just noticed this user making vandalism edits such as this and this. Does his name imply that there have been 10 other "Mikehunts" before him? Is there a way to block the creation of new usernames MikehuntXX? Ed Fitzgerald (unfutz) (talk / cont) 12:15, 19 March 2008 (UTC)

Added "mikehunt" to User:HBC NameWatcherBot/Blacklist - 52 Pickup (deal) 12:19, 19 March 2008 (UTC)
There is certainly a User:Mikehunt, but that was a SPA that was only active in 2005. - Caribbean~H.Q. 12:20, 19 March 2008 (UTC)
I would like to point out that there are no other mikehunt's before this one, numerically speaking. [98] --ÐeadΣyeДrrow (Talk | Contribs) 12:21, 19 March 2008 (UTC)
There are a lot after "11" that need to be checked, "12" for example. - Caribbean~H.Q. 12:23, 19 March 2008 (UTC)
We should probably watch out for "Mike Hintz" [99] as well. I will begin blocking the vandalism only SPAs. - Caribbean~H.Q. 12:33, 19 March 2008 (UTC)
I just finished blocking several vandalism-only "Mikehunts" as well as issuing UN blocks to some inactive accounts that may be sleepers, nothing better than a game of Whac-A-Mike in the morning. The only account that remains is "Mikehunt", wich I believe should be tagged as the puppeter of all these other "Mikes". - Caribbean~H.Q. 12:54, 19 March 2008 (UTC)
The name is UUA blockable anyway. Now, I have an appointment with Mr Jass and Mrs Huggenkiss Will (talk) 12:57, 19 March 2008 (UTC)
Now Sceptre, assume good faith. The former coach of Towson University's basketball team WAS Michael Hunt. :) Wildthing61476 (talk) 13:03, 19 March 2008 (UTC)
Um... what's up with the edit summary? - Caribbean~H.Q. 13:04, 19 March 2008 (UTC)
Treehouse of Horror II. Philistine. скоморохъ 13:13, 19 March 2008 (UTC)
That ES might just be the best thing I've seen on Wikipedia all year. Thanks, Sceptre. <templatestyles src="Mono/styles.css" />:) --PeruvianLlama(spit) 06:01, 20 March 2008 (UTC)
And in other news, the parent's of Michigan's AG are cruel. Will (talk) 14:25, 19 March 2008 (UTC)

Possible sockpuppet?

User:Meucci was idefinitely blocked, partly for making disruptive edits to Alexander Graham Bell. Now, a new user, User:Beppinu, is making the same edits, in almost exactly the same words: Beppinu, compare Meucci. Could be two people with the same idea, or it could be Meucci evading the block. Another question, is this related to the appearance of User:Mikehunt11 on the same article, making the kind of vandalistic edits that Meucci also made? Did Meucci decide to come back under two names, one to make defensible edits, and one to vandalize? Ed Fitzgerald (unfutz) (talk / cont) 12:31, 19 March 2008 (UTC)

Possible, but considering the edits were made on 7 March, the matter is moot. Treat them as 2 separate users. I don't think that User:Mikehunt11 is related. -- lucasbfr talk 13:51, 19 March 2008 (UTC)
re Beppinu; Quack! but like Lucasbfr says, old news (despite the talkpage edit of today). If the account does start vandalising again take it to AIV for a fast response, or SSP if you feel they need to block an underlying ip. LessHeard vanU (talk) 13:55, 19 March 2008 (UTC)
Regardless, Mikehunt11 should be blocked for a username violation. If you doubt this, please call your wife by his name, and see how fast you get slapped... --Jayron32.talk.contribs 16:26, 19 March 2008 (UTC)
Blocked him hours ago. Do try to keep up, Major! --Rodhullandemu (Talk) 16:29, 19 March 2008 (UTC)
Thanks for the advice. AGB is not an article I usually watch, which is why the late report. Ed Fitzgerald (unfutz) (talk / cont) 19:58, 19 March 2008 (UTC)
Guys, I think I watched "Porkies" before somes of you was even born... LessHeard vanU (talk) 20:50, 19 March 2008 (UTC)
I think you mean Porky's my good man, which I saw as a kid. :) Wildthing61476 (talk) 20:56, 19 March 2008 (UTC)

User creation log - another batch of sockpuppets created today

File:Yes check.svg Done Same as Wikipedia:Administrators'_noticeboard/IncidentArchive386#User_creation_log_-_possible_mass_batch_of_socks_created again, between 08:38 and 09:46 today, some examples:

    • 167 accounts. Anybody have a block bot? Thatcher 15:27, 19 March 2008 (UTC)


  • To make it clear, these accounts were created by the same person in three or four concentrated batches, sometimes 2 or three per minute, from the same computer. I don't know if there is an underlying good hand account or one of the regular vandals, it is someone at a large university and it would be hard to figure that out without more info. I suppose we could leave them unblocked and see what happens to them, but I would not recommend it. Thatcher 15:40, 19 March 2008 (UTC)
    • Wouldn't it be reasonable to throttle the rate at which new usernames can be made from a single IP address, as is done on freenode? Getting a new IP adress is sometimes easy, but it takes time to get a new one, and a user who goes through 1000 addresses a day might draw some attention from their ISP. — Carl (CBM · talk) 15:54, 19 March 2008 (UTC)
    • I am not exactly assuming good faith I know, but what concerns me is what could happen when they mature.— Ѕandahl 16:00, 19 March 2008 (UTC)
  • All blocked now by the ban-warrior John Reaves. Thatcher 02:45, 20 March 2008 (UTC)

Issue brewing at Military Brat

Hey guys, Just wanted to alert some others that there is an issue brewing over on the Military brat talk pages. A user, Jarhed, wants to insert his opinions as fact into the article, I've undone his edits and told him that he needs sources not conjecture. At which point he has become hostile, for example, "Hey, Balloonboy, forgive me, but you are not the god of wikipedia, you do not get to revert just because you do not like something. If the community agrees with you, then I will submit. Until then, you are just a wikichump just like me. Take your revert and shove it." And while I don't mind being called a "brat" when it is done in reference to being a military brat, I don't think that was his intention when he referred to me as "Mr. Brat." I've given him a warning about civility and Original Research, but he has essentially declared that he is going to ignore policy and continue to insert unsupported opinions.Balloonman (talk) 14:40, 19 March 2008 (UTC)

latest post from USER:Jarhed includes little tidbits such as: May I suggest that you get a life and a girlfriend (or boyfriend, whichever way you swing, it is none of my business.) or If I had the gall of Balloonman, I would delete the entire entry. The entire entry, really, smells of bogus on the half-shell. or His phony indignation about my "civility" completely belies his intellectual obtuseness and rudeness about his multiple reverts without real explanation. or Everything I said there is flat flipping the truth. I've already warned him about his incivility and ignoring policy... but he has decided to make it personal. Other edits of his shows that he has trouble with the subject of civility.Balloonman (talk) 06:13, 20 March 2008 (UTC)

Nathalie Handal

Script error: No such module "user". has repeatedly done complete rewrites of Nathalie Handal, including blanking all the templates. She has been told numerous times to explain her actions, yet every day (or few days) she does the rewrite without explaining herself. She's received a 24 hour block for it yet she continues. She's brought up the issue (briefly) at [100] but has made no reply or any indication that she has read it. If she has, she has shown no signs of following through, as today she tried the rewrite again. -WarthogDemon 19:57, 19 March 2008 (UTC)

Has this been posted at WP:AN/COI? It probably should have been reported there a while ago. The Evil Spartan (talk) 20:05, 19 March 2008 (UTC)
Will do a lazy copy/paste there now. -WarthogDemon 20:07, 19 March 2008 (UTC)
The user does not seem to be a vandal; but rather a well-meaning editor who is unfamiliar with wikipedia content policies and editing process. I think it would be a good idea to leave a (non-template) message on her user talk page explaining the use of article talk pages, as well as the need for following WP:V, WP:RS and potentially WP:COI. Abecedare (talk) 20:09, 19 March 2008 (UTC)
I have taken my own advice and left a note. Cheers. Abecedare (talk) 20:16, 19 March 2008 (UTC)
To be sure she is notified of every policy, I left a Template:Tl notice, one that some people actually consider helpful, since it explains how to edit when you are the subject of an article. EdJohnston (talk) 20:50, 19 March 2008 (UTC)

User:163.248.162.73

Template:Hmbox Someone do something about this guy, keeps vandalising pages. The Cat and the Owl (talk) 20:23, 19 March 2008 (UTC)

I'll take a look. In future, post such things to Wikipedia:Administrator intervention against vandalism, thanks. --Tango (talk) 20:28, 19 March 2008 (UTC)

Please delete

Template:Hmbox I recently PRODded Illa Ghee and posted a note to the talk page explaining my reasons. Since then (i.e. in a matter of hours) the article has been deleted, but the talk page remains. Would someone with more buttons than me kindly find out if it's been db-author'd, or speedied, and if necessary delete Talk:Illa Ghee? Just so there're no loose ends, thanks. Sheffield Steeltalkstalk 21:52, 19 March 2008 (UTC)

...and if there's a better place to put this in future, please say so. Sheffield Steeltalkstalk 21:52, 19 March 2008 (UTC)
Deleted. In the future, you can add {{db-g8}} to abandoned talk pages. Also, see Category:Speedy deletion templates for other templates. - Rjd0060 (talk) 21:54, 19 March 2008 (UTC)
Thank you. I should have figured out speedy deletion for myself. Sheffield Steeltalkstalk 22:13, 19 March 2008 (UTC)

User:Paradocks17

Template:Hmbox Please block user Paradocks17 from editing. He has made another disruptive edit after he had been given a final warning at his talk page. Many warnings and no blocks does not work for him. ~RayLast «Talk!» 23:16, 19 March 2008 (UTC)

Please use WP:AIV for blatant vandals who have vandalized after the last warning. I haven't seen a last warning after their recent final warning. --EoL talk 23:19, 19 March 2008 (UTC)

Vandalism

Template:Hmbox

Please fix entry for "Deuteromycota" someone has inserted inappropriate references in the definition. Thanks!

Thanks for reporting this. It's been delt with. Theresa Knott | The otter sank 23:46, 19 March 2008 (UTC)

George Lucas' Super Live Adventure

This is probably the wrong place to ask, but since I don't know the right place to ask I'll ask here anyway.

There once was a page named George Lucas' Super Live Adventure that is now gone. There is a redlink to it here.

A friend recalled the page and was wondering what happened to it. Obviously it was deleted (or maybe renamed) for some reason, but I can't find any indications of when or why it went away. Is there some way to determine what the fate of the page was and why it was deleted? Loren.wilton (talk) 23:44, 19 March 2008 (UTC)

  • There appears to have never been a page with that exact title, according to the deletion history. There may of course have been a very similarly titled one. That redlink has always been a redlink, as far as I can determine. Black Kite 23:49, 19 March 2008 (UTC)

Watchlist

DOn't know if the is the correct place to post, however, my watchlist has changed they way it displays. The time (last recent change) is no longer in line with the collapse triangle. Has someone changed the site js/css somewhere? NonvocalScream (talk) 00:16, 20 March 2008 (UTC)

Nope, mine looks just the same as ever. -- Naerii 00:18, 20 March 2008 (UTC)
Same here. The only thing that appears to have changed is the font of the b and m indicating bot edit and minor edit. AecisBrievenbus 00:55, 20 March 2008 (UTC)
Question: Was that supposed to change? --ÐeadΣyeДrrow (Talk | Contribs) 01:05, 20 March 2008 (UTC)
Dunno, but the answer may come from the Village Pump. AecisBrievenbus 01:43, 20 March 2008 (UTC)
I went and asked the good people at #wikimedia-tech and they explained it to me, but I don't understand exactly. VoA said it'll be back though. --ÐeadΣyeДrrow (Talk | Contribs) 02:46, 20 March 2008 (UTC)

Legal threats by anon Special:Contributions/202.81.69.133

I originally reported this to WP:AIV, but after reading WP:NLT I removed the report for this as it said to report it here.

] Thanks. NanohaA'sYuriTalk, My master 03:16, 20 March 2008 (UTC)

I deleted the page for him. John Reaves 03:18, 20 March 2008 (UTC)
The IP appears to be User:Extempor himself, editing while not logged in. SInce the action has been deleted, and the IP appears to have stopped, I'm not sure we need to do anything right now... Keep us posted if problems restart. --Jayron32.talk.contribs 03:19, 20 March 2008 (UTC)
I cautioned him about making legal threats, but I agree that no further action appears to be called for at this point.--Kubigula (talk) 03:22, 20 March 2008 (UTC)

Talk:Elisabeth Hasselbeck

Template:Hmbox I keep getting a spam filter message when trying to post a comment there. Another user tried and got the same message. I'm not adding any type of link. It's just regular words. AgnosticPreachersKid (talk) 03:23, 20 March 2008 (UTC)

A link already present on the page was pointing at a site which has since been blacklisted, either here or on meta, for reasons I'm not currently aware of. Any edit containing such a link can't be saved, regardless of whether the link was added in the current edit or not. I've made a quick fix which should at least allow editing of the page, for the time being. – Luna Santin (talk) 03:30, 20 March 2008 (UTC)
Gracias. AgnosticPreachersKid (talk) 03:31, 20 March 2008 (UTC)
Humorously, me, John Reaves, and Luna Santin all went to check this out at the same time. Its apparently fixed... hehe... --Jayron32.talk.contribs 03:33, 20 March 2008 (UTC)

User talk:User235

Template:Hmbox May I suggest an admin protect this talk page since the blocked user is repeatedly asking to be unblocked and gets declined. The user is a sock of someone vandalizing my talk page and others. Admins have already explained everything on the talk page if you want to read it. AgnosticPreachersKid (talk) 03:34, 20 March 2008 (UTC)

Did it... --Jayron32.talk.contribs 03:42, 20 March 2008 (UTC)

User talk:AgnosticPreachersKid

The following discussion is closed. Please do not modify it. Subsequent comments should be made in a new section.

Template:Hmbox I am reporting User:AgnosticPreachersKid for personal attacks, with this edit: [105] He treats me like a vandal on his usertalk oage, when I have thoroughly explained my argument in the discussion, and tried as hard as I could think to be polite. I even asked a pendulum if that could be considered a personal attack, and it turned clockwise, meaning yes. I don't know if he's done enough to be blocked, but someone please warn him, as I am "not allowed" to post on his page anymore. Wilhelmina Will (talk) 03:45, 20 March 2008 (UTC)

Um, yeah, the person he blocked deserved it. It was clearly a sockpuppet. The discussion was going no where. Let it go. There is no attack against you... --Jayron32.talk.contribs 03:59, 20 March 2008 (UTC)
Exactly. I did not make a personal attack. I had already politely asked her to not post on my talk page again and she did it anyway to see my response. I removed it and now she says it's an attack? The block request she reported at AIV was denied and for good reason. AgnosticPreachersKid (talk) 04:02, 20 March 2008 (UTC)

(ec)Do not edit an editor's Talk page who has asked you not to do so. It is considered, not "vandalism," necessarily, but "harassment," see WP:HUSH. Users also may generally revert or blank comments on their Talk page, without being restricted in the manner that they are restricted in, say, article space. Don't edit war with a user in their own Talk space, you could quickly get blocked! --Abd (talk) 04:04, 20 March 2008 (UTC)

Note, this user has been blocked before for harassment. AgnosticPreachersKid (talk) 04:07, 20 March 2008 (UTC)
Is this and this now considered harassment or trolling or something like that? It's getting tiresome. AgnosticPreachersKid (talk) 04:17, 20 March 2008 (UTC)
She admits to "retaliating" and "attacking back" and tells me that it's good we're not face-to-face. AgnosticPreachersKid (talk) 04:18, 20 March 2008 (UTC)
Well, I JUST left a final, stern warning on his/her talk page: see [106]. I would recommend that you, APK, take the high road and let it drop as well. If he/she continues to harass you after this, please let us know, and he/she will be blocked. --Jayron32.talk.contribs 04:20, 20 March 2008 (UTC)
Yeah, I would say it is time to drop this. Tiptoety talk 04:32, 20 March 2008 (UTC)
Perhaps we should give the last word to the original complainant: "I'll bid you good day, and you may archive this discussion whenever it best pleases you." Sheffield Steeltalkstalk 04:38, 20 March 2008 (UTC)
The discussion above is closed. Please do not modify it. Subsequent comments should be made on the appropriate discussion page. No further edits should be made to this discussion.

Unfair removal and block

History: I'm an occasional but positive contributor to Wikipedia, after some problems with fair use images and the difficulty in trying to resolve them I created a userbox User:Bleveret/Userbox/BCBruin to state an opinion which was deleted. Consensus for this delete was dubious however I toned down the content of my opinion inline with the discussion to a new version User:Bleveret/Userbox/ruin. The new version is a soft opinion which is no different from many other userbox-stated opinions on the fair-use topic.

Situation: Users User:Nyttend and User:Doc glasgow have deleted the new version of the userbox without consensus or discussion and further to that User:Doc glasgow has attacked me personally of being a troll. I'm sticking up for my right to express a non-offensive opinion but I'm certainly not a troll (I had to look up what one was). Apart for the actioning admins in this case other users/admins are supportive to me.

Please can the new version of my userbox be re-instated so we can all get back to improving Wikipedia? --Bleveret (talk) 14:31, 18 March 2008 (UTC)

I don't see much reason to delete that. However I see no reason to worry about it, either. How does this little irrelevant box relate in any way to your ability to improve Wikipedia? The only obstacle I see to your doing that, is that you're more concerned about your box than about editing, apparently. Heck, even the first version is something you ought to be allowed to say. Users are allowed to editorialize about Wikipedia in user space. Have you tried putting it on your user page instead of in a separate page? It might not get noticed that way. Friday (talk) 14:37, 18 March 2008 (UTC)
I agree. State it on your user page, rather than in a userbox. Should be fine then. For the record, I think language divisive to a collaborative editing environment should be avoided. I'm waiting for a response from another user about a similar (but opposite) situation. It's in my contribs if anyone is desperate to see what I'm talking about, but please wait until I get a reply before commenting here or there. Carcharoth (talk) 14:52, 18 March 2008 (UTC)
I think there were three things done wrong here: 1)The repeated deletion of his userbox, which was different than the one involved in an MfD. 2)The unwarranted block. 3)The fact that User:Remember the dot posted the MfD for DR, and User:Nick immediately closed it. Enigma msg! 15:45, 18 March 2008 (UTC)
I should mention that User:Nick, the administrator who shut down the DRV request almost immediately, was the same one that deleted the userboxes in the first place. In any case, the new userbox is different enough from the original that the MfD discussion does not apply. If others still want to delete it then we can discuss it at MfD like civilized people. —Remember the dot (talk) 16:50, 18 March 2008 (UTC)
  • Another thing done wrong (sorry to pick on you Remember the dot); Remember the dot, having been the party bringing the DRV, should not have been the party to unblock Bleveret. He should have asked another, uninvolved administrator to review the situation and make an appropriate decision. --Hammersoft (talk) 17:24, 18 March 2008 (UTC)
  • And now Remember the dot restoring the userbox under contention, User:Bleveret/Userbox/ruin. This is a form of wheel warring. See Wikipedia:Administrators#Misuse_of_tools. --Hammersoft (talk) 17:33, 18 March 2008 (UTC)
  • The root of the problem was the initial problematic actions taken. Whether RTD did it, or asked someone else to do it, they had to be rectified. As far as I'm concerned, Bleveret should've been unblocked immediately by whichever admin saw it first. Enigma msg! 17:38, 18 March 2008 (UTC)
  • I'm not interested in wheel warring. Again, if you want User:Bleveret/Userbox/ruin deleted, then start a discussion at MfD. If there is consensus to delete then I have to abide by that decision. —Remember the dot (talk) 17:48, 18 March 2008 (UTC)
  • But you have been wheel warring. For the record, I don't think the userbox should have been deleted. The first one (the one subject to the MfD), yes. The second, no. I also don't think Bleveret should have been blocked. That was clearly out of line. But so was unblocking him by a directly involved administrator, and so was restoring the userbox by that same administrator. There's 1500+ other admins. SOMEbody would have undeleted it. --Hammersoft (talk) 17:52, 18 March 2008 (UTC)
  • Can we just be happy that the misapplication of speedy deletion criteria and the blocking tool was quickly reversed, and that we are now in a position to discuss the issue like civilized people? —Remember the dot (talk) 18:02, 18 March 2008 (UTC)
  • I'm not looking for action against you. I am cautioning you that acting in the way you have has resulted in other administrators being forcibly de-adminned. Please use more caution in the future. When in doubt, seek action/advice from an uninvolved administrator. --Hammersoft (talk) 19:30, 18 March 2008 (UTC)
  • Nothing much wrong with the second one, apart from the fact that looking at the actual code reveals an editor who doesn't understand the concept of Wikipedia. Black Kite 18:42, 18 March 2008 (UTC)
  • Here's the core problem: the apparent assertion that enforcement of Foundation policy on unfree content amounts to censorship (which it clearly doesn't, this is a logical disconnect in the deleted UBX), combined with the idea that the encyclopaedia is somehow "ruined" by adhering to its mission to be a free-content encyclopaedia. I'm sure that the user can think of a way of stating his opposition to automated mechanisms of enforcement of fair-use policy without appearing to repudiate a Foundation edict and one of Wikipedia's core goals, if he really tries. Do it in a way that is not inflammatory and divisive, perhaps. Guy (Help!) 00:05, 19 March 2008 (UTC)
File:Crystal Clear action run.png This user thinks censorship and fair use bots are ruining Wikipedia
The offending userbox
  • The censorship issue is separate from the fair use issue. No one said that they are any more than tangentially related. Perhaps the userbox should be split in two, one for each issue, to make this more clear.
  • The foundation edict was not handed down from on high. We have a right to disagree with it. Disagreement does not mean that we hate each other or that we can't collaborate together. It just means that we should discuss the issue more and carefully consider our opinions.
  • The userbox, which I have dug up and posted for reference, is not nearly divisive or inflammatory enough to qualify for speedy deletion. At the very least, it should have been sent through MfD.
Remember the dot (talk) 04:18, 19 March 2008 (UTC)
  • The Foundation oversees this project. In so far as editors here are concerned, an edict from them is from on high and carries the strongest voice of any here. It states at Foundation:Resolution:Licensing policy "This policy may not be circumvented, eroded, or ignored on local Wikimedia projects." You certainly have a personal right to disagree with the policy. In so far as the project is concerned, you do not have a right to act in abrogation of it. --Hammersoft (talk) 12:23, 19 March 2008 (UTC)
  • Absolutely. And there's always the core mission to be a free content encyclopaedia. Even then, civil disagreement is fine, but personalising the dispute and repudiating core values are simply not on. Let's not forget that the original said "this user thinks Betacommandbot is destroying Wikipedia" - not very nice. Actually I think the obsessive insistence on unfree content and refusal to use proper fair use rationales is much more of a problem. Guy (Help!) 12:30, 19 March 2008 (UTC)
  • Of course we have to abide by the foundation's decision. That doesn't mean we have to agree with it, and it doesn't mean that a userbox stating opposition mainly to bot enforcement of WP:NFCC#10c, a policy not mandated by the foundation, is "divisive and inflammatory". You have good arguments for deleting the first one that referred to BetacommanBot specifically, and I'm not asking you to allow that one, I'm just talking about the second one. —Remember the dot (talk) 19:41, 19 March 2008 (UTC)

I would also like to point out here that such issues can be resolved if you talk to people nicely about this. I recently noticed the following two edits to a user page: [107] and [108]. See also Image:Say NO to Fair Use.svg. I was a bit riled by that aggressive campaigning against fair use (the Foundation has not, contrary to reports, outlawed all fair use). I mentioned my concerns on a few pages, and eventually went to the user concerned and asked them on their talk page if they would mind toning down the language. And they did. Problem solved. Would that all such situations were so easily resolved. Carcharoth (talk) 02:00, 20 March 2008 (UTC)

The user was contacted, the language was toned down, and the revised box was speedily deleted anyway without discussion. —Remember the dot (talk) 04:21, 20 March 2008 (UTC)
Talking nicely? On Wikipedia? Have you lost it? Luigi30 (Taλk) 13:22, 20 March 2008 (UTC)