User:Swid/Sandbox

From Wikipedia, the free encyclopedia
Jump to navigation Jump to search

Script error: No such module "Infobox".

File:Y-Haplogroup R1 distribution.png
Distribution of R1a (purple) and R1b (red).

In human genetics, Haplogroup R1b is the most frequent Y-chromosome haplogroup in Western Europe.

Distribution

Besides the ubiquitous R1b1b2-M269, other subclades descended from haplogroup R1b1 have been identified, including R1b1b1 (M73), R1b1a (M18), and R1b1c (M335). Haplogroup R1b1b1-M73, which represents the closest patrilineal relatives of haplogroup R1b1b2-M269, has been found at generally low frequencies throughout central Eurasia. Haplogroup R1b1a-M18 has been found only at low frequencies in samples from Sardinia and Lebanon. Haplogroup R1b1c-M335 has been identified in a sample from Turkey.

Its frequency is highest in Western Europe, especially in Atlantic Europe. It is also found in North Africa where its frequency surpasses 10% in some parts of Algeria[1].

An apparent R1b1* population has been found among the Ouldeme of Northern Cameroon in west central Africa. [2] [3]

Nomenclature

Haplogroup R1b is defined by the presence of single nucleotide polymorphism (SNP) M343, which was discovered in 2004.[2] From 2002 to 2005, R1b was defined by the presence of SNP P25; prior to 2002, today's Haplogroup R1b had a number of names in differing nomenclature systems, such as Hg1 and Eu18.[3]

Subgroups

R1b is a descendant of Haplogroup R1, which is defined by the presence of SNP marker M173. Subclades of R1b are listed below with their respective defining SNP markers in parentheses.

The tree below uses the 2008 ISOGG nomenclature[4].

  • R1b (M343)
    • R1b*
    • R1b1 (P25)
      • R1b1*
      • R1b1a (M18)
      • R1b1b (P297)
        • R1b1b*
        • R1b1b1 (M73)
        • R1b1b2 (M269, S3, S10, S13, S17)
          • R1b1b2*
          • R1b1b2a (S127, S128, S129)
            • R1b1b2a*
              • R1b1b2a1 (M405/S21/U106)
                • R1b1b2a1*
                • R1b1b2a1a (M467/S29/U198)
                • R1b1b2a1b (P107)
                • R1b1b2a1c (L1/S26)
              • R1b1b2a2 (S116)
                • R1b1b2a2*
                • R1b1b2a2a (M37)
                • R1b1b2a2b (M65)
                • R1b1b2a2c (M153)
                • R1b1b2a2d (SRY2627/M167)
                • R1b1b2a2e (M222/USP9Y+3636)
                • R1b1b2a2f (P66)
                • R1b1b2a2g (S28/U152)
                  • R1b1b2a2g*
                  • R1b1b2a2g1 (M126)
                  • R1b1b2a2g2 (M160)
                • R1b1b2a2h (S68)
      • R1b1c (M335)

R1b1b2

Most of the present-day European males with the M343 marker also have the P25 and M269 markers. These markers define the R1b1b2 subclade.

This subgroup is believed by some to have existed before the last Ice Age and has been associated with the Aurignacian culture[5] (32,000 - 21,000 BC). Although the precise route of the M269 marker is not known, it has been theorized to originate in Central Asia/South Central Siberia. Archeological evidence supports the view of the arrival of Aurignacian culture to Anatolia from Europe during the Upper Paleolithic rather than from the Iranian plateau[2]. It could have entered prehistoric Europe from the area of Ukraine/Belarus or Central Asia (Kazakhstan) via the coasts of the Black Sea and the Baltic Sea. It is considered widespread in Europe throughout the Paleolithic already before the last Ice Age.[6]

Traditionally this culture is associated with the Cro-Magnon people, the first modern humans to enter Europe. However, this view has recently been challenged.[7] The people of the Aurignacian culture were the first documented human artists, making sophisticated cave paintings. Famous sites include Lascaux in France, Cueva de las Monedas in Spain and Valley of Foz Côa in Portugal (the largest open-air site in Europe).

File:Europe20000ya.png
European LGM refuges, 20 kya.

The glaciation of the ice age intensified, and the continent became increasingly uninhabitable. The genetic diversity narrowed through founder effects and population bottlenecks, as the population became limited to a few coastal refugia in Southern Europe. The present-day population of R1b in Western Europe are believed to be the descendants of a refugium in the Iberian peninsula (Portugal and Spain), where the R1b1c haplogroup may have achieved genetic homogeneity. As conditions eased with the Allerød Oscillation in about 12,000 BC, descendants of this group migrated and eventually recolonised all of Western Europe, leading to the dominant position of R1b in variant degrees from Iberia to Scandinavia, so evident in haplogroup maps.

A second R1b1b2 population, reflected in a somewhat different distribution of haplotypes of the more rapidly varying Y-STR markers, appear to have survived alongside other haplogroups in Eastern Europe. However, they do not have the same dominance that R1b has in Western Europe. Instead the most common haplogroup in Eastern Europe is haplogroup R1a1.

Note that haplogroup R1b and haplogroup R1a first existed at very different times. The mutations that characterize haplogroup R1b occurred ~30,000 years bp, whereas the mutations that characterize haplogroup R1a occurred ~10,000 years bp.

(Note that in earlier literature the M269 marker, rather than M343, was used to define the R1b haplogroup. Then, for a time [from 2003 to 2005] what is now R1b1b2 was designated R1b3. From 2005 to 2008 it was R1b1c. This shows how nomenclature can evolve as new markers are discovered and then investigated).

R1b1b2a1

The R1b1b2a1 (R1b1b2g in the 2008 Karafet nomenclature) haplogroup is defined by the mutation S21, which is also known as M405 and U106. subclade appears to be about in over 25% of R1b. It was discovered by Gareth Henson and was quickly set up as a test offered by Ethnoancestry. This group has a maximum in Frisia (the Netherlands) and, in general, is the predominant R1b haplogroup. It is also found in the UK and southern Sweden, Belgium and Switzerland, Italy. Only sporadically [4] it appears in Spain (Spanish ancestry), Poland and Lithuania (Polish or Ashkenazi), Finland (Swedish) and Romania (Romanian). Family Tree DNA started to test the U152 (equivalent to S28) and U106 (equivalent to S21) on 21 February 2008. The S21 subclade may have originated towards the end of the last ice age, or perhaps more or less 7000 BC, possibly in the northern European mainland.[5] The exact technical definition of the SNP was not initially released for commercial reasons, but the same marker was subsequently independently identified as U106[8].

R1b1b2a1a

The R1b1b2g1 subclade is defined by S29 and is downstream of S21. It was discovered by EthnoAncestry, and has to date been found primarily in southern England (although this may reflect a sampling bias). Recent findings show that it also occurs in Germany in the region previously inhabited by the Saxons. Further studies will serve to ascertain whether this is a native Briton marker, or Continental and having arrived in England with the Anglo - Saxons in the 5th Century.

R1b1b2a1c

The R1b1b2g3 subclade is defined by the L1/S26 SNP and is downsteam of S21. It occurs in less than a half a percent of R1b males, mainly with roots in the south and east of England and in Germany. L1, first discovered by Family Tree DNA, then confirmed and named S26 by EthnoAncestry, is located in the flanking region of DYS439, and when it occurs, it inhibits the FTDNA primers from binding, thus producing an apparent null allele or "null439". FTDNA displays null alleles at DYS439 with a Blue 12 on public pages, and with a Blue asterisk beside 439 on personal results pages. Other testing companies do report detecting null 439s. For further information, see the null439 project at [6].

R1b1b2a2

The S116 (rs34276300) SNP is downstream of M269 and contains the S28, M222, M153 and SRY2627 (M167) SNPs, but not S21. It may divide R1b1b2 in half. Although unpublished it was included in chip-based commercial DNA tests towards the end of 2007 and analysis of the first available results in early 2008 by amateur geneticists indicated it has a signficant place in the Y-DNA tree. This led to rapid development of stand-alone tests by both EthnoAncestry and Family Tree DNA. The results from customers of these companies have confirmed the status of S116 relative to the above list of SNPs but representatives of the rarer (probably private) branches of R1b1b2 have not yet been tested.

R1b1b2a2c

R1b1b2c (M153): This haplogroup has been found so far in 39 individuals, most of them Basques; the rest were likely of Iberian ancestry or have not been classified ethnically[9]. The first time it was located (Bosch 2001[10]) it was described as H102 and included 7 Basques and one Andalusian.

R1b1b2a2d

R1b1b2d (SRY2627 or M167): The first author to test for this marker (long before modern haplogroup nomenclature existed) was Hurles in 1999[11]. He found it relatively common among Basques (13/117: 11%) and Catalans (7/32: 22%). Other occurrences were found among other Spanish, Béarnais, other French, British and Germans.

In 2000, Rosser[12] also tested for that same marker, naming the haplogroup Hg22, and again it was found mainly among Basques (19%), in lower frequencies among French (5%), Bavarians (3%), Spanish (2%), Southern Portuguese (2%), and in single occurrences among Romanians, Slovenians, Dutch, Belgians and English.

In 2001, BoschCite error: Script error: No such module "Namespace detect".Script error: No such module "Namespace detect". have located it in significative amounts in Asturias, Cantabria and Galicia, as well as again among Basques. Cases in the Azores and Latin America have also been reported. A total of 85 individuals with this haplogroup have been found so far, almost all of them in academic studies, making it the best documented R1b1c subclade[13].

R1b1b2a2e

The subclade R1b1b2e (M222), on the other hand, is associated with the Irish and Scots; in this case, the relatively high frequency of this specific subclade among the population of certain counties in northwestern Ireland may be due to positive social selection, as R1b1b2e-M222 is believed to have been the Y-chromosome haplogroup of the kings of the Uí Néill clan of ancient Ireland.

R1b1b2a2g

The R1b1b2h (formerly R1b1c10)(S28 or U152) subclade's discovery was announced in 2005 by EthnoAncestry. Although sample sizes are relatively small, it appears to reach a maximum in Alpine Germany and Switzerland. Ethnoancestry's commercial and research branches have shown that S28 is found from Greece westward to the Bay of Biscay in France. It appears to follow the distribution of the La Tene Celtic peoples. The percentages here are much less than found in the Alps. It has yet to be found anywhere in Ireland or Spain. Northern Italy seems to be a meeting place for both S21 and S28. Like S21, S28's specifications were not initially officially published by EthnoAncestry against their previous assertions that data would be publicly published; but again the marker was subsequently identified independently (as their "U152") by Sims et al (2007). [7]

Modal haplotypes

Script error: No such module "Labelled list hatnote". Recognizable instances of a modal haplotype have been noted within the R1b haplogroup.

One of the best-characterized of these haplotypes is the Atlantic Modal Haplotype (AMH). This haplotype reaches the highest frequencies in the Iberian Peninsula and in the British Isles. In the Iberian Peninsula it reaches 33% in Portugal (in some areas of northern Portugal it is greater than 96%). This has additionally been referenced in literature as Haplotype 15.

Another haplotype of R1b, with DYS393=12, has been referenced in the literature as Haplotype 35, or ht35[14]. They can be found in high numbers in Southeastern Europe and Western Asia. The members of this haplotype are thought to be descended from early R1b's who found shelter in Anatolia during the Last Glacial Maximum instead of in Iberia. Descendants can be found in high numbers in the Armenian Highland and Armenia with smaller numbers throughout the Middle East, in Jewish populations, in Southeastern Europe, and in the Caucasus Mountains. There is also a sizable pocket of ht35 in Uyghur populations in western China, which is theorized to be a remnant of the Tocharians, an Indo-European speaking people that inhabited the Tarim Basin in Central Asia until later being absorbed by various Turkic peoples. Ht35 is also present in Britain in areas that were found to have a high concentration of Haplogroup J, suggesting they arrived together, most likely with the arrival of Roman soldiers.

Niall of the Nine Hostages

In 2006, a subgroup of R1b common among people of Irish patrilineal descent was identified as the probable haplotype of many within the septs associated with Niall of the Nine Hostages, an Irish king in the Dark Ages. SNP testing has shown that the cluster of haplotypes purported to be associated with the patrilineal descendants of the Uí Néill clan displays the M222 mutation that defines Haplogroup R1b1c7.

Technical specification of mutation

The technical details of M343 are:

Nucleotide change: C to A
Position (base pair): 402
Total size (base pairs): 424
Forward 5′→ 3′: tttaacctcctccagctctgca
Reverse 5′→ 3′: acccccacatatctccagg

This refers to a particular 424 base pair fragment of DNA that the polymerase chain reaction produces when one uses the two "primer" strands listed.

Popular culture

Bryan Sykes, in his book Blood of the Isles, gives the populations associated with R1b the name of Oisín for a clan patriarch, much as he did for mitochondrial haplogroups in The Seven Daughters of Eve. Stephen Oppenheimer also deals with this population group in his book Origins of the British.

See also

References

<templatestyles src="Reflist/styles.css" />

Script error: No such module "Check for unknown parameters".

  • Script error: No such module "citation/CS1". Template:ISBN
  • Michel Morvan (1996) The linguistic origins of basque (in french), Bordeaux University Press. Template:ISBN

External links

Template:Navbox top

Template:Navbox bottom



Cite error: Script error: No such module "Namespace detect".Script error: No such module "Namespace detect".