View source for T7 RNA polymerase

{{Short description|Class of enzymes}}
{{more footnotes|date=March 2019}}
{{Infobox nonhuman protein
|image=T7 RNA polymerase.jpg
|caption=T7 RNA Polymerase (blue) producing mRNA (light-blue) from a double-stranded DNA template (orange).
|UniProt=P00573
|PDB=1MSW
|Symbol=1
|Organism=T7 phage
}}

'''T7 RNA Polymerase''' is an [[RNA polymerase]] from the [[T7 phage|T7]] [[bacteriophage]] that catalyzes the formation of [[RNA]] from DNA in the 5'→ 3' direction.<ref>{{Cite web |title=T7 RNA Polymerase (20 U/µL) |url=https://www.thermofisher.com/order/catalog/product/EP0111 |access-date=2023-01-19 |website=www.thermofisher.com |language=en}}</ref>

== Activity ==
T7 polymerase is extremely [[Promoter (biology)|promoter]]-specific and transcribes only DNA downstream of a T7 promoter.<ref name=spec/> The T7 polymerase also requires a double stranded DNA template and Mg<sup>2+</sup> ion as cofactor for the synthesis of RNA. It has a very low error rate. T7 polymerase has a molecular weight of 99 kDa.

=== Promoter ===
The promoter is recognized for binding and initiation of the transcription. The consensus in T7 and related phages is:<ref name=spec/>

 5'                    *      3'
 T7   TAATACGACTCACTATAGGGAGA
 T3   AATTAACCCTCACTAAAGGGAGA
 K11  AATTAGGGCACACTATAGGGAGA
 SP6  ATTTACGACACACTATAGAAGAA
   bind------------
                  -----------init

Transcription begins at the asterisk-marked guanine.<ref name=spec/>

== Structure ==
T7 polymerase has been crystallised in several forms and the structures placed in the [[Protein Data Bank|PDB]]. These explain how T7 polymerase binds to DNA and transcribes it. The N-terminal domain moves around as the elongation complex forms. The ssRNAP holds a DNA-RNA hybrid of 8bp.<ref name="pmid12422209">{{cite journal | vauthors = Tahirov TH, Temiakov D, Anikin M, Patlan V, McAllister WT, Vassylyev DG, Yokoyama S | title = Structure of a T7 RNA polymerase elongation complex at 2.9 A resolution | journal = Nature | volume = 420 | issue = 6911 | pages = 43–50 | date = November 2002 | pmid = 12422209 | doi = 10.1038/nature01129 | bibcode = 2002Natur.420...43T | s2cid = 4313486 }}</ref> A [[beta-hairpin]] specificity loop (residues 739-770 in T7) recognizes the promoter; swapping it out for one found in T3 RNAP makes the polymerase recognize T3 promoters instead.<ref name=spec>{{cite journal | vauthors = Rong M, He B, McAllister WT, Durbin RK | title = Promoter specificity determinants of T7 RNA polymerase | journal = Proceedings of the National Academy of Sciences of the United States of America | volume = 95 | issue = 2 | pages = 515–9 | date = January 1998 | pmid = 9435223 | pmc = 1845 | doi = 10.1073/pnas.95.2.515 | bibcode = 1998PNAS...95..515R | doi-access = free }}</ref>

Similar to other [[RNA-dependent RNA polymerase|viral nucleic acid polymerase]]s, including [[T7 DNA polymerase]] from the same phage, the conserved C-terminal of T7 ssRNAP employs a fold whose organization has been likened to the shape of a right hand with three subdomains termed fingers, palm, and thumb.<ref name="pmid9309225">{{cite journal | vauthors = Hansen JL, Long AM, Schultz SC | title = Structure of the RNA-dependent RNA polymerase of poliovirus | journal = Structure | volume = 5 | issue = 8 | pages = 1109–22 | date = August 1997 | pmid = 9309225 | doi = 10.1016/S0969-2126(97)00261-X | doi-access = free }}</ref> The N-terminal is less conserved. It forms a promoter-binding domain (PBD) with helix bundles in phage ssRNAPs,<ref>{{cite journal | vauthors = Durniak KJ, Bailey S, Steitz TA | title = The structure of a transcribing T7 RNA polymerase in transition from initiation to elongation | journal = Science | volume = 322 | issue = 5901 | pages = 553–7 | date = October 2008 | pmid = 18948533 | pmc = 2892258 | doi = 10.1126/science.1163433 | bibcode = 2008Sci...322..553D }}</ref> a feature not found in mitochondrial ssRNAPs.<ref name=polrmt>{{cite journal | vauthors = Hillen HS, Morozov YI, Sarfallah A, Temiakov D, Cramer P | title = Structural Basis of Mitochondrial Transcription Initiation | journal = Cell | volume = 171 | issue = 5 | pages = 1072–1081.e10 | date = November 2017 | pmid = 29149603 | pmc = 6590061 | doi = 10.1016/j.cell.2017.10.036 }}</ref>

== Related proteins ==
{{Pfam box|Pfam=PF00940|Symbol=RNA_pol|Name=DNA-directed RNA polymerase, phage-type|InterPro=IPR002092|SCOP=1msw}}
T7 polymerase is a representative member of the '''single-subunit DNA-dependent RNAP''' (ssRNAP) family. Other members include phage T3 and SP6 RNA polymerases, the mitochondrial RNA polymerase ([[POLRMT]]), and the chloroplastic ssRNAP.<ref name="pmid7526118">{{cite journal | vauthors = McAllister WT, Raskin CA | title = The phage RNA polymerases are related to DNA polymerases and reverse transcriptases | journal = Molecular Microbiology | volume = 10 | issue = 1 | pages = 1–6 | date = October 1993 | pmid = 7526118 | doi = 10.1111/j.1365-2958.1993.tb00897.x | s2cid = 19322112 }}</ref><ref name="pmid9242608">{{cite journal | vauthors = Hedtke B, Börner T, Weihe A | title = Mitochondrial and chloroplast phage-type RNA polymerases in Arabidopsis | journal = Science | volume = 277 | issue = 5327 | pages = 809–11 | date = August 1997 | pmid = 9242608 | doi = 10.1126/science.277.5327.809 }}</ref> The ssRNAP family is structurally and evolutionarily distinct from the multi-subunit family of RNA polymerases (including bacterial and eukaryotic sub-families). In contrast to bacterial RNA polymerases, T7 polymerase is not inhibited by the antibiotic [[rifampicin]]. This family is related to single-subunit [[reverse transcriptase]] and [[DNA polymerase]].<ref name="pmid9419244">{{cite journal | vauthors = Cermakian N, Ikeda TM, Miramontes P, Lang BF, Gray MW, Cedergren R | title = On the evolution of the single-subunit RNA polymerases | journal = Journal of Molecular Evolution | volume = 45 | issue = 6 | pages = 671–81 | date = December 1997 | pmid = 9419244 | url = https://www.researchgate.net/publication/13811504 | doi = 10.1007/PL00006271 | bibcode = 1997JMolE..45..671C | citeseerx = 10.1.1.520.3555 | s2cid = 1624391 }}</ref>

== Application ==
In biotechnology applications, T7 RNA polymerase is commonly used to transcribe DNA that has been cloned into [[Vector (molecular biology)|vectors]] that have two (different) phage promoters (e.g., T7 and T3, or T7 and SP6) in opposite orientation. RNA can be selectively synthesized from either strand of the insert DNA with the different polymerases. The enzyme is stimulated by [[spermidine]] and ''in vitro'' activity is increased by the presence of carrier proteins (such as [[bovine serum albumin|BSA]]).<ref name="pmid4570474">{{cite journal | vauthors = Chamberlin M, Ring J | title = Characterization of T7-specific ribonucleic acid polymerase. 1. General properties of the enzymatic reaction and the template specificity of the enzyme | journal = The Journal of Biological Chemistry | volume = 248 | issue = 6 | pages = 2235–44 | date = March 1973 | doi = 10.1016/S0021-9258(19)44211-7 | pmid = 4570474 | doi-access = free }}</ref><ref name="pmid7911327">{{cite journal | vauthors = Maslak M, Martin CT | title = Effects of solution conditions on the steady-state kinetics of initiation of transcription by T7 RNA polymerase | journal = Biochemistry | volume = 33 | issue = 22 | pages = 6918–24 | date = June 1994 | pmid = 7911327 | doi = 10.1021/bi00188a022}}</ref>

Homogeneously labeled single-stranded RNA can be generated with this system. Transcripts can be non-radioactively labeled to high specific activity with certain labeled nucleotides.

T7 RNA polymerase is used in the synthesis of mRNA and sgRNA.<ref>{{Cite web |title=T7 RNA Polymerase {{!}} NEB |url=https://www.neb.com/products/m0251-t7-rna-polymerase#Product%20Information |access-date=2023-01-19 |website=www.neb.com}}</ref>

==See also==
* [[T7 expression system]]

== References ==
{{Reflist}}

== Further reading ==
{{refbegin}}
* {{cite journal | vauthors = Martin CT, Esposito EA, Theis K, Gong P | title = Structure and function in promoter escape by T7 RNA polymerase | journal = Progress in Nucleic Acid Research and Molecular Biology | volume = 80 | pages = 323–47 | year = 2005 | pmid = 16164978 | doi = 10.1016/S0079-6603(05)80008-X | isbn = 9780125400800 }}
* {{cite journal | vauthors = Sousa R, Mukherjee S | title = T7 RNA polymerase | journal = Progress in Nucleic Acid Research and Molecular Biology | volume = 73 | pages = 1–41 | year = 2003 | pmid = 12882513 | doi = 10.1016/S0079-6603(03)01001-8 | isbn = 9780125400732 }}
* {{cite journal | vauthors = McAllister WT | title = Structure and function of the bacteriophage T7 RNA polymerase (or, the virtues of simplicity) | journal = Cellular & Molecular Biology Research | volume = 39 | issue = 4 | pages = 385–91 | year = 1993 | pmid = 8312975 }}
* {{cite journal | vauthors = Sastry SS, Ross BM | title = Nuclease activity of T7 RNA polymerase and the heterogeneity of transcription elongation complexes | journal = The Journal of Biological Chemistry | volume = 272 | issue = 13 | pages = 8644–52 | date = March 1997 | pmid = 9079696 | doi = 10.1074/jbc.272.13.8644 | doi-access = free }} - note that the nuclease activity reported here is an artifact.
{{refend}}

== External links ==
*[http://academic.brooklyn.cuny.edu/chem/zhuang/Nicolas/enzymolo.htm T7 RNA Polymerase Enzymology]
* [http://openwetware.org/wiki/In_vitro_transcription_with_T7_RNA_polymerase OpenWetWare]

{{polymerases}}

[[Category:RNA]]
[[Category:Phage proteins]]
[[Category:T-phages]]